Incidental Mutation 'R2680:Ppp1ca'
List |< first << previous [record 46 of 66] next >> last >|
ID250985
Institutional Source Beutler Lab
Gene Symbol Ppp1ca
Ensembl Gene ENSMUSG00000040385
Gene Nameprotein phosphatase 1, catalytic subunit, alpha isoform
Synonymsdism2, Ppp1c
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4192158-4195419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4194595 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 218 (E218K)
Ref Sequence ENSEMBL: ENSMUSP00000039109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025740] [ENSMUST00000045864] [ENSMUST00000046094]
Predicted Effect probably benign
Transcript: ENSMUST00000025740
SMART Domains Protein: ENSMUSP00000025740
Gene: ENSMUSG00000024824

DomainStartEndE-ValueType
Pfam:Rad9 13 265 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045864
SMART Domains Protein: ENSMUSP00000042660
Gene: ENSMUSG00000040247

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
TBC 87 301 7.1e-61 SMART
low complexity region 393 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000046094
AA Change: E218K

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039109
Gene: ENSMUSG00000040385
AA Change: E218K

DomainStartEndE-ValueType
PP2Ac 30 300 1.4e-164 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies in both human and mice suggest that PP1 is an important regulator of cardiac function. Mouse studies also suggest that PP1 functions as a suppressor of learning and memory. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Ppp1ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ppp1ca APN 19 4193144 missense probably benign 0.25
IGL00834:Ppp1ca APN 19 4194520 missense probably benign 0.20
IGL01017:Ppp1ca APN 19 4193111 missense probably damaging 0.96
IGL02150:Ppp1ca APN 19 4194699 splice site probably benign
IGL02295:Ppp1ca APN 19 4194482 nonsense probably null
R0022:Ppp1ca UTSW 19 4194581 missense possibly damaging 0.51
R0022:Ppp1ca UTSW 19 4194581 missense possibly damaging 0.51
R3978:Ppp1ca UTSW 19 4192254 missense probably benign 0.05
R4514:Ppp1ca UTSW 19 4195055 missense probably benign
R5131:Ppp1ca UTSW 19 4194896 missense probably damaging 1.00
R7606:Ppp1ca UTSW 19 4193089 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGACAGCACTTGGTTTAAG -3'
(R):5'- CACCAACTGTCTCTTGGCAAAG -3'

Sequencing Primer
(F):5'- CAGCACTTGGTTTAAGGAACAC -3'
(R):5'- CTGTCTCTTGGCAAAGAACTCATAGC -3'
Posted On2014-12-04