Incidental Mutation 'R2495:Rfx6'
ID250988
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Nameregulatory factor X, 6
SynonymsRfxdc1, 4930572O07Rik
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location51677756-51730432 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 51726675 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]
Predicted Effect probably benign
Transcript: ENSMUST00000050455
SMART Domains Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900

DomainStartEndE-ValueType
Blast:HisKA 91 153 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122922
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217662
Predicted Effect probably benign
Transcript: ENSMUST00000219364
Predicted Effect probably benign
Transcript: ENSMUST00000219771
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51681886 missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51678405 missense probably benign 0.16
IGL01639:Rfx6 APN 10 51715906 nonsense probably null
IGL01721:Rfx6 APN 10 51723077 missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51721579 missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51726856 missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51678012 missense probably benign
IGL02479:Rfx6 APN 10 51678328 missense probably benign 0.07
IGL02592:Rfx6 APN 10 51716023 missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51716026 missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51723846 missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51723121 nonsense probably null
IGL03263:Rfx6 APN 10 51725807 missense probably benign 0.00
IGL03373:Rfx6 APN 10 51720000 missense probably damaging 0.99
bulky UTSW 10 51678333 missense probably benign 0.00
R0060:Rfx6 UTSW 10 51677840 missense probably benign 0.00
R0433:Rfx6 UTSW 10 51720028 missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51693737 missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51678402 missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51723125 critical splice donor site probably null
R2017:Rfx6 UTSW 10 51721604 missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51720057 critical splice donor site probably null
R2044:Rfx6 UTSW 10 51718126 missense probably benign 0.16
R2655:Rfx6 UTSW 10 51693777 splice site probably benign
R2912:Rfx6 UTSW 10 51718130 missense probably damaging 1.00
R3159:Rfx6 UTSW 10 51726720 missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51726746 missense probably damaging 1.00
R4536:Rfx6 UTSW 10 51723784 missense probably benign 0.16
R4791:Rfx6 UTSW 10 51719944 splice site probably null
R4945:Rfx6 UTSW 10 51726851 nonsense probably null
R5223:Rfx6 UTSW 10 51677996 nonsense probably null
R5233:Rfx6 UTSW 10 51712091 nonsense probably null
R5448:Rfx6 UTSW 10 51683637 missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51723061 missense probably damaging 1.00
R5768:Rfx6 UTSW 10 51726880 missense probably damaging 0.99
R5858:Rfx6 UTSW 10 51725868 missense probably benign 0.00
R5949:Rfx6 UTSW 10 51678333 missense probably benign 0.00
R6001:Rfx6 UTSW 10 51718211 splice site probably null
R6003:Rfx6 UTSW 10 51708587 missense probably damaging 1.00
R6118:Rfx6 UTSW 10 51711866 missense possibly damaging 0.91
R6629:Rfx6 UTSW 10 51725490 missense probably benign 0.02
R6876:Rfx6 UTSW 10 51719991 missense probably damaging 1.00
R6894:Rfx6 UTSW 10 51716039 missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51723853 missense probably benign 0.00
R7130:Rfx6 UTSW 10 51678380 nonsense probably null
R7574:Rfx6 UTSW 10 51681818 missense probably benign 0.17
R7845:Rfx6 UTSW 10 51678026 missense probably benign 0.05
R8188:Rfx6 UTSW 10 51718196 missense probably benign 0.05
R8338:Rfx6 UTSW 10 51718094 missense probably damaging 0.96
V8831:Rfx6 UTSW 10 51718208 critical splice donor site probably null
X0023:Rfx6 UTSW 10 51678411 missense probably damaging 1.00
Z1176:Rfx6 UTSW 10 51718093 missense probably benign 0.05
Z1176:Rfx6 UTSW 10 51725831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGTGTTTCTTCATGAACATG -3'
(R):5'- AACGAGTTGTTCTGCTTCCG -3'

Sequencing Primer
(F):5'- GTGTTTCTTCATGAACATGATTCTG -3'
(R):5'- CGGCTGCTGTCATCTAAAATG -3'
Posted On2014-12-04