Incidental Mutation 'R2495:Adamts14'
ID250990
Institutional Source Beutler Lab
Gene Symbol Adamts14
Ensembl Gene ENSMUSG00000059901
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14
SynonymsAdamts-14, TS14
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61197112-61273438 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 61198970 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]
Predicted Effect probably null
Transcript: ENSMUST00000092486
SMART Domains Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 194 6.3e-30 PFAM
Pfam:Reprolysin_5 245 424 6e-17 PFAM
Pfam:Reprolysin_4 246 432 2.5e-7 PFAM
Pfam:Reprolysin 246 447 1.9e-21 PFAM
Pfam:Reprolysin_2 264 437 9.2e-10 PFAM
Pfam:Reprolysin_3 268 396 2.5e-12 PFAM
TSP1 542 594 5.9e-16 SMART
Pfam:ADAM_spacer1 701 816 1.8e-24 PFAM
TSP1 837 894 2.1e-2 SMART
TSP1 897 956 3.42e-3 SMART
TSP1 959 1009 4.48e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120336
SMART Domains Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 194 1.6e-38 PFAM
Pfam:Reprolysin_5 245 427 5.9e-16 PFAM
Pfam:Reprolysin_4 246 435 1.1e-7 PFAM
Pfam:Reprolysin 246 450 3.2e-20 PFAM
Pfam:Reprolysin_2 264 441 5.5e-12 PFAM
Pfam:Reprolysin_3 268 399 1.5e-13 PFAM
TSP1 545 597 5.9e-16 SMART
Pfam:ADAM_spacer1 704 819 8e-25 PFAM
TSP1 840 897 2.1e-2 SMART
TSP1 900 959 3.42e-3 SMART
TSP1 962 1012 4.48e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Adamts14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Adamts14 APN 10 61229676 missense probably damaging 1.00
IGL00800:Adamts14 APN 10 61205418 missense probably benign 0.00
IGL01021:Adamts14 APN 10 61225373 missense probably damaging 0.99
IGL01022:Adamts14 APN 10 61202942 missense probably benign 0.01
IGL01335:Adamts14 APN 10 61198681 missense possibly damaging 0.90
IGL01419:Adamts14 APN 10 61205542 splice site probably benign
IGL01595:Adamts14 APN 10 61205473 missense probably damaging 1.00
R0594:Adamts14 UTSW 10 61202887 missense probably damaging 1.00
R0629:Adamts14 UTSW 10 61211624 nonsense probably null
R1459:Adamts14 UTSW 10 61198804 missense probably benign 0.13
R1565:Adamts14 UTSW 10 61270897 missense probably damaging 1.00
R1686:Adamts14 UTSW 10 61198660 missense probably benign
R1792:Adamts14 UTSW 10 61218498 missense probably benign 0.07
R1876:Adamts14 UTSW 10 61200372 missense probably benign 0.03
R1992:Adamts14 UTSW 10 61198660 missense probably benign
R2064:Adamts14 UTSW 10 61205522 missense probably benign 0.24
R2848:Adamts14 UTSW 10 61218435 missense probably damaging 1.00
R2897:Adamts14 UTSW 10 61204910 missense probably damaging 0.99
R3428:Adamts14 UTSW 10 61224374 missense probably benign 0.36
R4006:Adamts14 UTSW 10 61202821 critical splice donor site probably null
R5129:Adamts14 UTSW 10 61249618 missense probably benign 0.02
R5327:Adamts14 UTSW 10 61198488 missense probably benign 0.01
R5524:Adamts14 UTSW 10 61230443 missense probably damaging 1.00
R5594:Adamts14 UTSW 10 61227101 splice site probably null
R5694:Adamts14 UTSW 10 61229652 missense probably benign 0.45
R5801:Adamts14 UTSW 10 61202996 missense probably damaging 0.99
R5941:Adamts14 UTSW 10 61221895 missense probably damaging 1.00
R5953:Adamts14 UTSW 10 61207446 missense probably damaging 0.99
R6778:Adamts14 UTSW 10 61225452 missense probably damaging 1.00
R7169:Adamts14 UTSW 10 61204928 missense probably damaging 0.97
R7215:Adamts14 UTSW 10 61211596 missense possibly damaging 0.89
R7337:Adamts14 UTSW 10 61207460 missense probably damaging 0.98
R7511:Adamts14 UTSW 10 61218528 missense possibly damaging 0.74
R7640:Adamts14 UTSW 10 61246057 missense probably benign 0.00
R7798:Adamts14 UTSW 10 61271173 missense probably damaging 0.99
R7902:Adamts14 UTSW 10 61205397 missense possibly damaging 0.92
R8062:Adamts14 UTSW 10 61200361 critical splice donor site probably null
R8284:Adamts14 UTSW 10 61198659 missense possibly damaging 0.55
R8319:Adamts14 UTSW 10 61221927 missense probably benign
Z1088:Adamts14 UTSW 10 61218445 missense probably damaging 1.00
Z1177:Adamts14 UTSW 10 61198843 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGTAGACTTCACATCCTCCAGG -3'
(R):5'- TCCTACGCACTGGAAGTTG -3'

Sequencing Primer
(F):5'- TGCTGGCAAGAGACTCCCAG -3'
(R):5'- AACAGTTTTGCCCCATCGTAGAG -3'
Posted On2014-12-04