Incidental Mutation 'R2696:Speg'
ID250993
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene NameSPEG complex locus
SynonymsSPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
MMRRC Submission 040434-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2696 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75375297-75432320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75406926 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1186 (D1186V)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113587] [ENSMUST00000113588] [ENSMUST00000113589] [ENSMUST00000113590] [ENSMUST00000122266]
Predicted Effect probably benign
Transcript: ENSMUST00000087122
AA Change: D1186V

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: D1186V

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113587
SMART Domains Protein: ENSMUSP00000109217
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113588
SMART Domains Protein: ENSMUSP00000109218
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113589
SMART Domains Protein: ENSMUSP00000109219
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113590
SMART Domains Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 186 212 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 253 262 N/A INTRINSIC
low complexity region 306 317 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
IGc2 633 700 2.19e-9 SMART
low complexity region 752 764 N/A INTRINSIC
IGc2 780 848 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122266
SMART Domains Protein: ENSMUSP00000113646
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137868
AA Change: D933V
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,850,364 T540S probably benign Het
Acp7 G T 7: 28,614,576 H369Q probably benign Het
Adgrg3 A G 8: 95,021,074 N65S probably benign Het
Anln A G 9: 22,360,963 V620A probably benign Het
Atp10a T A 7: 58,813,618 S966R probably benign Het
Atp8b3 T A 10: 80,534,183 Q132L possibly damaging Het
Col4a1 T A 8: 11,235,092 probably null Het
Ddx21 T C 10: 62,594,092 H291R possibly damaging Het
Dlgap3 A G 4: 127,194,623 Y4C probably damaging Het
Dnah5 A G 15: 28,278,576 N1106D probably benign Het
Esyt1 T C 10: 128,517,045 D662G probably damaging Het
F830016B08Rik T A 18: 60,300,736 V297E possibly damaging Het
Faf1 T A 4: 109,841,328 N328K possibly damaging Het
Gdf3 A C 6: 122,606,900 F169L probably benign Het
Ifi213 G A 1: 173,590,024 T274I probably benign Het
Igf2r T C 17: 12,695,344 D1746G possibly damaging Het
Ighv1-75 T C 12: 115,834,206 K32R probably benign Het
Ipo8 T A 6: 148,796,741 Q594L probably benign Het
Krt83 A T 15: 101,487,009 I402N probably benign Het
Med18 G A 4: 132,459,970 R118W probably damaging Het
Mmrn2 A G 14: 34,398,415 E414G probably damaging Het
Myo6 A G 9: 80,260,894 T447A probably benign Het
Ncoa6 T C 2: 155,438,015 E27G probably benign Het
Ngly1 T C 14: 16,283,439 L406S possibly damaging Het
Olfr125 T C 17: 37,835,107 I36T probably benign Het
Olfr630 A G 7: 103,755,528 I19T probably damaging Het
Phldb1 T C 9: 44,718,288 Y156C probably damaging Het
Pkd2l1 T A 19: 44,157,269 T172S probably benign Het
Pknox2 G A 9: 36,909,691 R292* probably null Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Polr3e T C 7: 120,933,377 L212P probably damaging Het
Ppp4r4 A G 12: 103,581,394 I215M possibly damaging Het
Psmg2 T C 18: 67,648,218 Y127H possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptp4a1 A T 1: 30,946,132 M4K probably benign Het
R3hcc1l A T 19: 42,563,988 I475L possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rsf1 GGC GGCGGCGGCGGC 7: 97,579,933 probably benign Het
Sec63 T A 10: 42,783,526 I70N probably benign Het
Slc2a5 A C 4: 150,120,746 K4T probably benign Het
Slc4a3 A G 1: 75,555,475 Y939C possibly damaging Het
Slc7a15 T C 12: 8,529,345 *229W probably null Het
Slco1a6 C A 6: 142,112,936 G206C probably damaging Het
Spata9 A G 13: 75,977,776 Q126R probably benign Het
Spink5 T G 18: 43,982,292 M197R probably damaging Het
Stab2 T C 10: 86,861,499 D1975G probably benign Het
Syngap1 T A 17: 26,957,411 C224* probably null Het
Ttn T C 2: 76,868,463 probably benign Het
Txnrd1 G A 10: 82,885,282 E397K probably benign Het
Ugt2b36 A T 5: 87,089,485 M313K probably damaging Het
Ulk3 A G 9: 57,590,441 I74V possibly damaging Het
Zcchc4 T C 5: 52,796,231 V194A probably damaging Het
Zfp27 C T 7: 29,896,367 A58T possibly damaging Het
Zfp398 T G 6: 47,866,945 *512E probably null Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
R7794:Speg UTSW 1 75388870 missense probably benign 0.00
R7824:Speg UTSW 1 75384017 intron probably null
R7834:Speg UTSW 1 75384927 missense probably damaging 1.00
R7892:Speg UTSW 1 75427166 missense probably damaging 1.00
R8015:Speg UTSW 1 75415421 splice site probably benign
R8068:Speg UTSW 1 75422250 missense probably damaging 1.00
R8085:Speg UTSW 1 75415353 missense probably damaging 1.00
R8130:Speg UTSW 1 75415596 missense probably damaging 1.00
R8132:Speg UTSW 1 75422995 missense probably damaging 1.00
R8239:Speg UTSW 1 75419033 missense probably damaging 1.00
R8287:Speg UTSW 1 75422236 missense probably benign 0.26
R8299:Speg UTSW 1 75387836 missense possibly damaging 0.95
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Z1176:Speg UTSW 1 75406594 missense probably damaging 1.00
Z1177:Speg UTSW 1 75427683 missense probably damaging 1.00
Z1177:Speg UTSW 1 75428381 missense probably damaging 1.00
Z1177:Speg UTSW 1 75430455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGCCACCAACACTCATGG -3'
(R):5'- CATACACTGTGTCATGCGTCG -3'

Sequencing Primer
(F):5'- CAGCTGTATGTGGAGGAGCCTC -3'
(R):5'- CGGTCGTCACTGCTTTGAATGC -3'
Posted On2014-12-04