Incidental Mutation 'R2495:Zfp287'
ID250996
Institutional Source Beutler Lab
Gene Symbol Zfp287
Ensembl Gene ENSMUSG00000005267
Gene Namezinc finger protein 287
SynonymsB230333C16Rik, SKAT-2
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location62700356-62731905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62714633 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 483 (C483S)
Ref Sequence ENSEMBL: ENSMUSP00000141046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005399] [ENSMUST00000149228] [ENSMUST00000150336] [ENSMUST00000185656]
Predicted Effect probably damaging
Transcript: ENSMUST00000005399
AA Change: C472S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005399
Gene: ENSMUSG00000005267
AA Change: C472S

DomainStartEndE-ValueType
SCAN 27 138 1e-50 SMART
KRAB 155 212 5.79e-20 SMART
low complexity region 253 262 N/A INTRINSIC
ZnF_C2H2 355 377 5.9e-3 SMART
ZnF_C2H2 383 405 2.61e-4 SMART
ZnF_C2H2 411 433 5.59e-4 SMART
ZnF_C2H2 439 461 3.44e-4 SMART
ZnF_C2H2 467 489 9.73e-4 SMART
ZnF_C2H2 495 517 2.43e-4 SMART
ZnF_C2H2 523 545 4.54e-4 SMART
ZnF_C2H2 551 573 2.57e-3 SMART
ZnF_C2H2 579 601 4.87e-4 SMART
ZnF_C2H2 607 629 1.3e-4 SMART
ZnF_C2H2 635 657 4.79e-3 SMART
ZnF_C2H2 663 685 2.95e-3 SMART
ZnF_C2H2 691 713 3.63e-3 SMART
ZnF_C2H2 719 741 1.38e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149228
AA Change: C483S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114531
Gene: ENSMUSG00000005267
AA Change: C483S

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150336
SMART Domains Protein: ENSMUSP00000121717
Gene: ENSMUSG00000005267

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185656
AA Change: C483S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141046
Gene: ENSMUSG00000005267
AA Change: C483S

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Meta Mutation Damage Score 0.4565 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the krueppel family of zinc finger proteins, suggesting a role as a transcription factor. Its specific function has not been determined. This gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Zfp287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Zfp287 APN 11 62713890 nonsense probably null
IGL01868:Zfp287 APN 11 62715257 missense probably benign 0.22
IGL03290:Zfp287 APN 11 62715236 missense probably damaging 0.98
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0193:Zfp287 UTSW 11 62715029 missense probably benign 0.12
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0525:Zfp287 UTSW 11 62715244 missense probably benign
R0725:Zfp287 UTSW 11 62714213 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1416:Zfp287 UTSW 11 62714340 missense probably damaging 1.00
R1487:Zfp287 UTSW 11 62725289 missense probably damaging 1.00
R2023:Zfp287 UTSW 11 62714982 nonsense probably null
R2045:Zfp287 UTSW 11 62727569 missense probably damaging 1.00
R3794:Zfp287 UTSW 11 62714244 missense probably damaging 1.00
R3902:Zfp287 UTSW 11 62712202 missense probably benign 0.00
R4816:Zfp287 UTSW 11 62714248 missense probably damaging 1.00
R4928:Zfp287 UTSW 11 62714136 nonsense probably null
R5048:Zfp287 UTSW 11 62714951 missense probably damaging 0.98
R5858:Zfp287 UTSW 11 62714007 missense probably damaging 1.00
R6349:Zfp287 UTSW 11 62725342 missense probably damaging 0.99
R6964:Zfp287 UTSW 11 62724817 missense probably damaging 1.00
R7024:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R7252:Zfp287 UTSW 11 62724829 missense probably damaging 1.00
R7318:Zfp287 UTSW 11 62714278 missense probably damaging 1.00
R7548:Zfp287 UTSW 11 62713875 nonsense probably null
R7658:Zfp287 UTSW 11 62725263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGCACCCTGTCTGTAAGC -3'
(R):5'- TGAGTGTGAAGAATGCGGCA -3'

Sequencing Primer
(F):5'- TAAGTGCTCTGGCTGAACAC -3'
(R):5'- TACGAATGCCACCAGTGTG -3'
Posted On2014-12-04