Mutagenetix > Incidental Mutation

Incidental Mutation 'R2495:Cntrob'

250999

Institutional Source

Beutler Lab

Gene Symbol

Cntrob

Ensembl Gene

ENSMUSG00000032782

Gene Name

centrobin, centrosomal BRCA2 interacting protein

Synonyms

Lip8, 9830165K03Rik

MMRRC Submission

040409-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R2495 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69299487-69323775 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 69322923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 14 (P14T)

Ref Sequence

ENSEMBL: ENSMUSP00000090651 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018614] [ENSMUST00000060956] [ENSMUST00000092973] [ENSMUST00000102601] [ENSMUST00000102602] [ENSMUST00000108662] [ENSMUST00000123176]

AlphaFold

Q8CB62

Predicted Effect

probably benign
Transcript: ENSMUST00000018614

SMART Domains

Protein: ENSMUSP00000018614
Gene: ENSMUSG00000018470

Domain	Start	End	E-Value	Type
low complexity region	23	49	N/A	INTRINSIC
low complexity region	54	65	N/A	INTRINSIC
Pfam:Aldo_ket_red	92	396	1.6e-70	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000060956

SMART Domains

Protein: ENSMUSP00000050153
Gene: ENSMUSG00000049299

Domain	Start	End	E-Value	Type
Pfam:Sybindin	3	109	2.2e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000092973
AA Change: P14T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: P14T

Domain	Start	End	E-Value	Type
coiled coil region	191	218	N/A	INTRINSIC
coiled coil region	249	557	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102601

SMART Domains

Protein: ENSMUSP00000099661
Gene: ENSMUSG00000049299

Domain	Start	End	E-Value	Type
Pfam:Sybindin	3	137	1.4e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102602

SMART Domains

Protein: ENSMUSP00000099662
Gene: ENSMUSG00000049299

Domain	Start	End	E-Value	Type
Pfam:Sybindin	3	137	1.4e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108662

SMART Domains

Protein: ENSMUSP00000104302
Gene: ENSMUSG00000049299

Domain	Start	End	E-Value	Type
Pfam:Sybindin	3	127	2.2e-42	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123176
AA Change: P14T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125777

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140555

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142328

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176111

Predicted Effect

probably benign
Transcript: ENSMUST00000176938

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	C	3: 36,481,960	F125S	unknown	Het
Abhd17c	C	T	7: 84,110,676	W290*	probably null	Het
Acsl5	A	T	19: 55,293,599	K536*	probably null	Het
Adamts14	A	T	10: 61,198,970		probably null	Het
Agbl3	A	G	6: 34,846,764	H788R	probably damaging	Het
Agrp	T	C	8: 105,566,776	N126D	possibly damaging	Het
Ambn	T	C	5: 88,467,804	I349T	probably benign	Het
Ank1	T	C	8: 23,132,264	W1610R	probably damaging	Het
Aox3	T	C	1: 58,188,408	L1224P	probably damaging	Het
Arhgef28	A	T	13: 98,029,373		probably benign	Het
Bcl11b	G	A	12: 107,915,447	H798Y	possibly damaging	Het
Capn11	T	A	17: 45,638,763	M426L	probably damaging	Het
Cep95	A	G	11: 106,809,282	K290E	possibly damaging	Het
Cic	A	G	7: 25,291,776		probably benign	Het
Cnbd1	A	T	4: 18,860,579	M389K	probably damaging	Het
Cnksr1	A	T	4: 134,232,162	L387Q	probably benign	Het
Crmp1	G	A	5: 37,246,097		probably null	Het
Dido1	A	G	2: 180,689,388	V89A	probably benign	Het
Dnah7a	T	A	1: 53,605,881	I999F	probably damaging	Het
Dsp	T	A	13: 38,193,477	L1746Q	possibly damaging	Het
Dst	T	C	1: 34,199,373	S3897P	probably damaging	Het
Fbxo10	A	G	4: 45,040,545	F887L	probably benign	Het
Gm21961	T	A	15: 65,014,873	H11L	unknown	Het
Gm4559	A	T	7: 142,273,820	C182S	unknown	Het
Gm5724	C	A	6: 141,765,777	M69I	probably benign	Het
Golga3	T	A	5: 110,207,596	S939T	probably damaging	Het
Got2	A	G	8: 95,888,290	S6P	possibly damaging	Het
Gpatch8	A	T	11: 102,478,481	H1410Q	probably damaging	Het
Gpx5	T	A	13: 21,291,440	T39S	probably benign	Het
Grin2b	T	C	6: 135,733,182	Y1122C	probably damaging	Het
Gsn	A	C	2: 35,303,193	N538T	probably damaging	Het
Helz2	A	G	2: 181,232,912	S1930P	probably damaging	Het
Krt6b	A	T	15: 101,678,322	F286Y	probably damaging	Het
Lrriq1	G	A	10: 103,202,381	R854C	probably damaging	Het
Mipol1	A	T	12: 57,460,990		probably benign	Het
Mmp19	A	G	10: 128,790,950		probably benign	Het
Msc	T	G	1: 14,755,249	Y167S	probably benign	Het
Mycbp2	T	G	14: 103,200,118	K2103Q	probably damaging	Het
Myh11	C	A	16: 14,205,557	D1586Y	probably damaging	Het
Nol6	A	T	4: 41,118,427	D791E	probably damaging	Het
Pcm1	A	G	8: 41,293,579	T1272A	probably benign	Het
Phgdh	A	G	3: 98,339,789	L15P	probably damaging	Het
Ptprk	A	T	10: 28,475,078		probably benign	Het
Ralgapa2	G	T	2: 146,361,400	D1091E	possibly damaging	Het
Rbbp8nl	C	A	2: 180,279,102	K496N	probably null	Het
Rbm26	T	C	14: 105,151,312		probably benign	Het
Rfx6	A	C	10: 51,726,675		probably benign	Het
Rras	G	A	7: 45,018,064	G17R	probably damaging	Het
Shisa6	G	A	11: 66,217,633	P473S	probably damaging	Het
Slc9a3	A	G	13: 74,158,703	K316E	probably damaging	Het
Spata31d1a	A	G	13: 59,701,993	S774P	possibly damaging	Het
Spsb4	T	C	9: 96,995,787	Y161C	probably damaging	Het
Taf3	G	T	2: 9,952,833	N174K	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Trnt1	T	A	6: 106,773,369	V78E	possibly damaging	Het
Ubox5	A	T	2: 130,599,521	C415*	probably null	Het
Ucn2	C	T	9: 108,986,409	P80S	possibly damaging	Het
Vmn2r10	G	A	5: 108,996,095	T663I	probably damaging	Het
Wdfy1	A	T	1: 79,707,505	F337L	probably null	Het
Zfp287	A	T	11: 62,714,633	C483S	probably damaging	Het
Zyg11b	A	G	4: 108,244,724		probably null	Het

Other mutations in Cntrob

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02975:Cntrob	APN	11	69319373	missense	possibly damaging	0.66
IGL03173:Cntrob	APN	11	69310027	missense	possibly damaging	0.90
groats	UTSW	11	69309491	nonsense	probably null
BB005:Cntrob	UTSW	11	69300295	missense	probably damaging	0.97
BB015:Cntrob	UTSW	11	69300295	missense	probably damaging	0.97
R0270:Cntrob	UTSW	11	69311341	missense	possibly damaging	0.66
R0501:Cntrob	UTSW	11	69322868	missense	probably damaging	1.00
R1749:Cntrob	UTSW	11	69322874	missense	probably damaging	0.99
R1775:Cntrob	UTSW	11	69320867	missense	possibly damaging	0.90
R1900:Cntrob	UTSW	11	69308054	missense	probably benign	0.27
R1967:Cntrob	UTSW	11	69320963	missense	probably damaging	0.97
R3121:Cntrob	UTSW	11	69322700	nonsense	probably null
R3780:Cntrob	UTSW	11	69302882	missense	probably damaging	0.97
R4449:Cntrob	UTSW	11	69305549	missense	probably benign	0.29
R4696:Cntrob	UTSW	11	69320888	missense	probably damaging	1.00
R4841:Cntrob	UTSW	11	69315394	missense	possibly damaging	0.92
R4842:Cntrob	UTSW	11	69315394	missense	possibly damaging	0.92
R4908:Cntrob	UTSW	11	69320906	missense	probably damaging	0.97
R4982:Cntrob	UTSW	11	69311362	splice site	probably null
R5168:Cntrob	UTSW	11	69299990	missense	possibly damaging	0.66
R5187:Cntrob	UTSW	11	69321891	missense	possibly damaging	0.62
R5307:Cntrob	UTSW	11	69314750	missense	possibly damaging	0.66
R5473:Cntrob	UTSW	11	69322753	missense	possibly damaging	0.81
R5903:Cntrob	UTSW	11	69309375	missense	possibly damaging	0.83
R6643:Cntrob	UTSW	11	69311422	missense	possibly damaging	0.46
R6742:Cntrob	UTSW	11	69322923	missense	probably damaging	0.96
R6964:Cntrob	UTSW	11	69309491	nonsense	probably null
R7020:Cntrob	UTSW	11	69303092	critical splice donor site	probably null
R7425:Cntrob	UTSW	11	69314734	nonsense	probably null
R7928:Cntrob	UTSW	11	69300295	missense	probably damaging	0.97
R7946:Cntrob	UTSW	11	69315221	missense	possibly damaging	0.82
R8348:Cntrob	UTSW	11	69299853	missense	unknown
R8448:Cntrob	UTSW	11	69299853	missense	unknown
R8539:Cntrob	UTSW	11	69320826	missense	possibly damaging	0.94
R9259:Cntrob	UTSW	11	69320839	missense	possibly damaging	0.81
R9415:Cntrob	UTSW	11	69302915	missense	possibly damaging	0.66
R9553:Cntrob	UTSW	11	69314853	missense	probably benign	0.00
R9626:Cntrob	UTSW	11	69311341	missense	possibly damaging	0.66
R9628:Cntrob	UTSW	11	69322956	missense	possibly damaging	0.66
R9801:Cntrob	UTSW	11	69321407	missense	possibly damaging	0.82
Z1177:Cntrob	UTSW	11	69311449	missense	possibly damaging	0.66
Z1186:Cntrob	UTSW	11	69305578	missense	probably benign
Z1186:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1187:Cntrob	UTSW	11	69305578	missense	probably benign
Z1187:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1188:Cntrob	UTSW	11	69305578	missense	probably benign
Z1188:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1189:Cntrob	UTSW	11	69305578	missense	probably benign
Z1189:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1190:Cntrob	UTSW	11	69305578	missense	probably benign
Z1190:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1191:Cntrob	UTSW	11	69305578	missense	probably benign
Z1191:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1192:Cntrob	UTSW	11	69305578	missense	probably benign
Z1192:Cntrob	UTSW	11	69308056	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- CAGTTCTTGAGCCAAGCTGTC -3'
(R):5'- TCTGGAGTCAGTGGACACTC -3'

Sequencing Primer
(F):5'- CTGTCTAAGCCCTCGTTAGG -3'
(R):5'- GGAGTCAGTGGACACTCCTCTAAC -3'

Posted On

2014-12-04