Incidental Mutation 'R2495:Cep95'
ID 251003
Institutional Source Beutler Lab
Gene Symbol Cep95
Ensembl Gene ENSMUSG00000018372
Gene Name centrosomal protein 95
Synonyms F630025I20Rik, Ccdc45, 4732496G21Rik
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock # R2495 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 106789252-106819930 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106809282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 290 (K290E)
Ref Sequence ENSEMBL: ENSMUSP00000099357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018516] [ENSMUST00000103068]
AlphaFold Q8BVV7
Predicted Effect probably benign
Transcript: ENSMUST00000018516
AA Change: K333E

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000018516
Gene: ENSMUSG00000018372
AA Change: K333E

DomainStartEndE-ValueType
low complexity region 389 407 N/A INTRINSIC
coiled coil region 584 633 N/A INTRINSIC
coiled coil region 701 793 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103068
AA Change: K290E

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099357
Gene: ENSMUSG00000018372
AA Change: K290E

DomainStartEndE-ValueType
low complexity region 346 364 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
coiled coil region 658 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133581
Meta Mutation Damage Score 0.2365 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Cep95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cep95 APN 11 106818217 missense probably damaging 0.98
IGL00988:Cep95 APN 11 106806394 missense probably benign 0.00
IGL01306:Cep95 APN 11 106813815 missense probably benign 0.00
IGL01995:Cep95 APN 11 106806371 missense probably damaging 1.00
IGL02541:Cep95 APN 11 106815581 missense probably damaging 0.99
ANU23:Cep95 UTSW 11 106813815 missense probably benign 0.00
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0255:Cep95 UTSW 11 106811271 missense probably benign 0.10
R0427:Cep95 UTSW 11 106790752 missense probably benign 0.18
R0436:Cep95 UTSW 11 106818685 missense probably null 0.98
R0583:Cep95 UTSW 11 106814623 missense probably benign
R0831:Cep95 UTSW 11 106814704 missense probably benign 0.00
R1459:Cep95 UTSW 11 106817955 missense probably damaging 1.00
R1589:Cep95 UTSW 11 106800104 missense probably benign 0.00
R1627:Cep95 UTSW 11 106809705 missense probably damaging 1.00
R1768:Cep95 UTSW 11 106806351 nonsense probably null
R1914:Cep95 UTSW 11 106814638 missense probably damaging 1.00
R1915:Cep95 UTSW 11 106814638 missense probably damaging 1.00
R1928:Cep95 UTSW 11 106790728 unclassified probably benign
R3157:Cep95 UTSW 11 106809187 splice site probably benign
R3158:Cep95 UTSW 11 106809187 splice site probably benign
R3712:Cep95 UTSW 11 106811286 nonsense probably null
R3881:Cep95 UTSW 11 106806292 missense probably damaging 0.98
R4739:Cep95 UTSW 11 106815734 missense probably benign 0.34
R4908:Cep95 UTSW 11 106811346 missense probably damaging 1.00
R4989:Cep95 UTSW 11 106816654 splice site probably null
R5913:Cep95 UTSW 11 106818509 unclassified probably benign
R5925:Cep95 UTSW 11 106812401 missense probably benign 0.00
R6291:Cep95 UTSW 11 106815596 missense probably damaging 1.00
R6540:Cep95 UTSW 11 106801502 missense probably damaging 0.97
R6924:Cep95 UTSW 11 106811197 missense probably damaging 0.99
R6985:Cep95 UTSW 11 106818703 missense probably damaging 0.99
R7156:Cep95 UTSW 11 106809224 missense possibly damaging 0.84
R7940:Cep95 UTSW 11 106796148 missense probably benign
R8348:Cep95 UTSW 11 106813767 missense possibly damaging 0.81
R8509:Cep95 UTSW 11 106805050 missense probably benign 0.08
R8849:Cep95 UTSW 11 106816804 missense
R9284:Cep95 UTSW 11 106813798 missense probably benign
X0028:Cep95 UTSW 11 106812410 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCTGGACAGTCTCTGCTG -3'
(R):5'- TTAAGGGGAGTGACTTGCCAC -3'

Sequencing Primer
(F):5'- GGACAGTCTCTGCTGGCTTC -3'
(R):5'- GAGTGACTTGCCACCGTTAC -3'
Posted On 2014-12-04