Incidental Mutation 'R2495:Mipol1'
ID 251004
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 6030439O22Rik, D12Ertd19e, 1700081O04Rik
MMRRC Submission 040409-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2495 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 57277211-57504027 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 57507776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000123498
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130447
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145003
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153137
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,536,109 (GRCm39) F125S unknown Het
Abhd17c C T 7: 83,759,884 (GRCm39) W290* probably null Het
Acsl5 A T 19: 55,282,031 (GRCm39) K536* probably null Het
Adamts14 A T 10: 61,034,749 (GRCm39) probably null Het
Agbl3 A G 6: 34,823,699 (GRCm39) H788R probably damaging Het
Agrp T C 8: 106,293,408 (GRCm39) N126D possibly damaging Het
Ambn T C 5: 88,615,663 (GRCm39) I349T probably benign Het
Ank1 T C 8: 23,622,280 (GRCm39) W1610R probably damaging Het
Aox3 T C 1: 58,227,567 (GRCm39) L1224P probably damaging Het
Arhgef28 A T 13: 98,165,881 (GRCm39) probably benign Het
Bcl11b G A 12: 107,881,706 (GRCm39) H798Y possibly damaging Het
Capn11 T A 17: 45,949,689 (GRCm39) M426L probably damaging Het
Cep95 A G 11: 106,700,108 (GRCm39) K290E possibly damaging Het
Cic A G 7: 24,991,201 (GRCm39) probably benign Het
Cnbd1 A T 4: 18,860,579 (GRCm39) M389K probably damaging Het
Cnksr1 A T 4: 133,959,473 (GRCm39) L387Q probably benign Het
Cntrob G T 11: 69,213,749 (GRCm39) P14T probably damaging Het
Crmp1 G A 5: 37,403,441 (GRCm39) probably null Het
Dido1 A G 2: 180,331,181 (GRCm39) V89A probably benign Het
Dnah7a T A 1: 53,645,040 (GRCm39) I999F probably damaging Het
Dsp T A 13: 38,377,453 (GRCm39) L1746Q possibly damaging Het
Dst T C 1: 34,238,454 (GRCm39) S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 (GRCm39) F887L probably benign Het
Gm21961 T A 15: 64,886,722 (GRCm39) H11L unknown Het
Gm4559 A T 7: 141,827,557 (GRCm39) C182S unknown Het
Golga3 T A 5: 110,355,462 (GRCm39) S939T probably damaging Het
Got2 A G 8: 96,614,918 (GRCm39) S6P possibly damaging Het
Gpatch8 A T 11: 102,369,307 (GRCm39) H1410Q probably damaging Het
Gpx5 T A 13: 21,475,610 (GRCm39) T39S probably benign Het
Grin2b T C 6: 135,710,180 (GRCm39) Y1122C probably damaging Het
Gsn A C 2: 35,193,205 (GRCm39) N538T probably damaging Het
Helz2 A G 2: 180,874,705 (GRCm39) S1930P probably damaging Het
Krt6b A T 15: 101,586,757 (GRCm39) F286Y probably damaging Het
Lrriq1 G A 10: 103,038,242 (GRCm39) R854C probably damaging Het
Mmp19 A G 10: 128,626,819 (GRCm39) probably benign Het
Msc T G 1: 14,825,473 (GRCm39) Y167S probably benign Het
Mycbp2 T G 14: 103,437,554 (GRCm39) K2103Q probably damaging Het
Myh11 C A 16: 14,023,421 (GRCm39) D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 (GRCm39) D791E probably damaging Het
Pcm1 A G 8: 41,746,616 (GRCm39) T1272A probably benign Het
Phgdh A G 3: 98,247,105 (GRCm39) L15P probably damaging Het
Ptprk A T 10: 28,351,074 (GRCm39) probably benign Het
Ralgapa2 G T 2: 146,203,320 (GRCm39) D1091E possibly damaging Het
Rbbp8nl C A 2: 179,920,895 (GRCm39) K496N probably null Het
Rbm26 T C 14: 105,388,748 (GRCm39) probably benign Het
Rfx6 A C 10: 51,602,771 (GRCm39) probably benign Het
Rras G A 7: 44,667,488 (GRCm39) G17R probably damaging Het
Shisa6 G A 11: 66,108,459 (GRCm39) P473S probably damaging Het
Slc9a3 A G 13: 74,306,822 (GRCm39) K316E probably damaging Het
Slco1a7 C A 6: 141,711,503 (GRCm39) M69I probably benign Het
Spata31d1a A G 13: 59,849,807 (GRCm39) S774P possibly damaging Het
Spsb4 T C 9: 96,877,840 (GRCm39) Y161C probably damaging Het
Taf3 G T 2: 9,957,644 (GRCm39) N174K probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Trnt1 T A 6: 106,750,330 (GRCm39) V78E possibly damaging Het
Ubox5 A T 2: 130,441,441 (GRCm39) C415* probably null Het
Ucn2 C T 9: 108,815,477 (GRCm39) P80S possibly damaging Het
Vmn2r10 G A 5: 109,143,961 (GRCm39) T663I probably damaging Het
Wdfy1 A T 1: 79,685,222 (GRCm39) F337L probably null Het
Zfp287 A T 11: 62,605,459 (GRCm39) C483S probably damaging Het
Zyg11b A G 4: 108,101,921 (GRCm39) probably null Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57,354,139 (GRCm39) splice site probably benign
IGL01139:Mipol1 APN 12 57,352,821 (GRCm39) nonsense probably null
IGL02679:Mipol1 APN 12 57,352,829 (GRCm39) missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57,411,010 (GRCm39) missense probably benign 0.20
R0001:Mipol1 UTSW 12 57,507,625 (GRCm39) splice site probably benign
R0220:Mipol1 UTSW 12 57,503,936 (GRCm39) missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57,507,740 (GRCm39) unclassified probably benign
R0284:Mipol1 UTSW 12 57,503,855 (GRCm39) missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57,503,963 (GRCm39) missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57,461,197 (GRCm39) critical splice donor site probably null
R1082:Mipol1 UTSW 12 57,372,402 (GRCm39) missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57,352,874 (GRCm39) missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57,379,127 (GRCm39) missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57,379,205 (GRCm39) missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57,352,842 (GRCm39) splice site probably null
R3723:Mipol1 UTSW 12 57,503,878 (GRCm39) missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57,350,310 (GRCm39) missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57,399,534 (GRCm39) intron probably benign
R4654:Mipol1 UTSW 12 57,352,918 (GRCm39) missense probably benign 0.22
R4847:Mipol1 UTSW 12 57,350,282 (GRCm39) missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57,379,087 (GRCm39) missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57,543,285 (GRCm39) missense probably benign 0.36
R5668:Mipol1 UTSW 12 57,372,346 (GRCm39) missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57,352,886 (GRCm39) missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57,372,321 (GRCm39) missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57,503,852 (GRCm39) missense probably benign 0.01
R7560:Mipol1 UTSW 12 57,352,859 (GRCm39) missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57,352,874 (GRCm39) missense possibly damaging 0.86
R8752:Mipol1 UTSW 12 57,372,367 (GRCm39) missense probably damaging 1.00
R8772:Mipol1 UTSW 12 57,372,418 (GRCm39) missense probably benign 0.23
R8861:Mipol1 UTSW 12 57,352,802 (GRCm39) missense probably benign 0.00
R8928:Mipol1 UTSW 12 57,507,651 (GRCm39) missense probably benign 0.00
R9011:Mipol1 UTSW 12 57,503,865 (GRCm39) missense probably benign 0.03
R9250:Mipol1 UTSW 12 57,461,169 (GRCm39) missense probably damaging 1.00
R9383:Mipol1 UTSW 12 57,352,820 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGTTCCTCAGGTATCCTTCTC -3'
(R):5'- ACTATTGTAACACTGAAAGGAACAG -3'

Sequencing Primer
(F):5'- AGGTATCCTTCTCTCCCAACAGG -3'
(R):5'- CCATCTGTCCAGCATGAA -3'
Posted On 2014-12-04