Incidental Mutation 'R2495:Bcl11b'
ID251006
Institutional Source Beutler Lab
Gene Symbol Bcl11b
Ensembl Gene ENSMUSG00000048251
Gene NameB cell leukemia/lymphoma 11B
Synonyms9130430L19Rik, CTIP2, B630002E05Rik, COUP-TF interacting protein 2, Rit1
MMRRC Submission 040409-MU
Accession Numbers

Genbank: NM_001079883; MGI: 1929913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2495 (G1)
Quality Score127
Status Validated
Chromosome12
Chromosomal Location107910403-108003602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107915447 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 798 (H798Y)
Ref Sequence ENSEMBL: ENSMUSP00000105517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066060] [ENSMUST00000109887] [ENSMUST00000109891]
AlphaFold Q99PV8
Predicted Effect probably benign
Transcript: ENSMUST00000066060
AA Change: H870Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068258
Gene: ENSMUSG00000048251
AA Change: H870Y

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Blast:ZnF_C2H2 56 81 5e-10 BLAST
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 221 244 1.16e-1 SMART
low complexity region 311 330 N/A INTRINSIC
ZnF_C2H2 426 448 6.23e-2 SMART
ZnF_C2H2 454 476 2.75e-3 SMART
low complexity region 519 551 N/A INTRINSIC
low complexity region 566 593 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 743 765 N/A INTRINSIC
ZnF_C2H2 786 808 1.41e0 SMART
ZnF_C2H2 814 836 4.24e-4 SMART
ZnF_C2H2 844 867 3.07e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109887
AA Change: H676Y
SMART Domains Protein: ENSMUSP00000105513
Gene: ENSMUSG00000048251
AA Change: H676Y

DomainStartEndE-ValueType
ZnF_C2H2 27 50 1.16e-1 SMART
low complexity region 117 136 N/A INTRINSIC
ZnF_C2H2 232 254 6.23e-2 SMART
ZnF_C2H2 260 282 2.75e-3 SMART
low complexity region 325 357 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 549 571 N/A INTRINSIC
ZnF_C2H2 592 614 1.41e0 SMART
ZnF_C2H2 620 642 4.24e-4 SMART
ZnF_C2H2 650 673 3.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109891
AA Change: H798Y

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105517
Gene: ENSMUSG00000048251
AA Change: H798Y

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Pfam:zf-C2H2_6 55 83 3.9e-9 PFAM
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 149 172 1.16e-1 SMART
low complexity region 239 258 N/A INTRINSIC
ZnF_C2H2 354 376 6.23e-2 SMART
ZnF_C2H2 382 404 2.75e-3 SMART
low complexity region 447 479 N/A INTRINSIC
low complexity region 494 521 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
ZnF_C2H2 714 736 1.41e0 SMART
ZnF_C2H2 742 764 4.24e-4 SMART
ZnF_C2H2 772 795 3.07e-1 SMART
Meta Mutation Damage Score 0.1430 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. Although the specific function of this gene has not been determined, the encoded protein is known to be a transcriptional repressor, and is regulated by the NURD nucleosome remodeling and histone deacetylase complex. Four alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Animals homozygous for a mutation of this gene are born with open eyes, exhibit abnormalities of the thymus, and die within 1 day after birth. Mice heterozygous for a hypomorphic allele and a knock-out allele exhibit lethality at weaning due to maxillaryincisor hyperplasia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Bcl11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Bcl11b APN 12 107965815 missense possibly damaging 0.46
IGL02492:Bcl11b APN 12 107915686 missense probably damaging 0.98
IGL02559:Bcl11b APN 12 107915394 utr 3 prime probably benign
IGL02950:Bcl11b APN 12 107989806 missense probably benign 0.00
Activia UTSW 12 108003143 start codon destroyed probably benign 0.21
R0055:Bcl11b UTSW 12 107965777 missense probably benign 0.02
R0762:Bcl11b UTSW 12 107965663 intron probably benign
R1549:Bcl11b UTSW 12 107917163 missense probably damaging 0.97
R1682:Bcl11b UTSW 12 107916649 missense probably damaging 1.00
R2269:Bcl11b UTSW 12 107915651 missense possibly damaging 0.71
R3053:Bcl11b UTSW 12 107916001 missense probably benign 0.01
R4094:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4095:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4155:Bcl11b UTSW 12 107917425 splice site probably null
R4156:Bcl11b UTSW 12 107917425 splice site probably null
R4157:Bcl11b UTSW 12 107917425 splice site probably null
R4611:Bcl11b UTSW 12 107916530 missense probably damaging 0.97
R4900:Bcl11b UTSW 12 107989698 missense probably damaging 1.00
R4906:Bcl11b UTSW 12 107916709 missense probably damaging 1.00
R4982:Bcl11b UTSW 12 107965772 nonsense probably null
R5108:Bcl11b UTSW 12 107965726 missense probably benign 0.04
R5190:Bcl11b UTSW 12 107989716 missense probably damaging 1.00
R6380:Bcl11b UTSW 12 108003101 missense probably benign 0.20
R6423:Bcl11b UTSW 12 107915419 missense possibly damaging 0.82
R6792:Bcl11b UTSW 12 107989734 missense probably damaging 1.00
R7026:Bcl11b UTSW 12 107916592 missense probably damaging 0.99
R7074:Bcl11b UTSW 12 107989507 missense probably benign 0.01
R7371:Bcl11b UTSW 12 107989491 missense probably damaging 1.00
R7454:Bcl11b UTSW 12 107916208 missense possibly damaging 0.93
R7590:Bcl11b UTSW 12 108003143 start codon destroyed probably benign 0.21
R8005:Bcl11b UTSW 12 107916197 missense probably benign
R8131:Bcl11b UTSW 12 107965708 missense probably benign
R8783:Bcl11b UTSW 12 107917303 missense probably damaging 1.00
R8914:Bcl11b UTSW 12 107916904 missense probably damaging 0.98
X0018:Bcl11b UTSW 12 107989689 missense probably damaging 1.00
X0021:Bcl11b UTSW 12 107916877 missense probably damaging 0.97
Z1177:Bcl11b UTSW 12 107989740 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACACAGGTTAGGCTGGAC -3'
(R):5'- ACTGTAGCAACCTGACGGTG -3'

Sequencing Primer
(F):5'- GACTGCCGCCTCCCTGG -3'
(R):5'- CGGAGGAGCCACACCGG -3'
Posted On2014-12-04