Incidental Mutation 'R2495:Bcl11b'
ID 251006
Institutional Source Beutler Lab
Gene Symbol Bcl11b
Ensembl Gene ENSMUSG00000048251
Gene Name B cell leukemia/lymphoma 11B
Synonyms 9130430L19Rik, CTIP2, B630002E05Rik, COUP-TF interacting protein 2, Rit1
MMRRC Submission 040409-MU
Accession Numbers

Genbank: NM_001079883; MGI: 1929913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2495 (G1)
Quality Score 127
Status Validated
Chromosome 12
Chromosomal Location 107910403-108003602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 107915447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 798 (H798Y)
Ref Sequence ENSEMBL: ENSMUSP00000105517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066060] [ENSMUST00000109887] [ENSMUST00000109891]
AlphaFold Q99PV8
Predicted Effect probably benign
Transcript: ENSMUST00000066060
AA Change: H870Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068258
Gene: ENSMUSG00000048251
AA Change: H870Y

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Blast:ZnF_C2H2 56 81 5e-10 BLAST
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 221 244 1.16e-1 SMART
low complexity region 311 330 N/A INTRINSIC
ZnF_C2H2 426 448 6.23e-2 SMART
ZnF_C2H2 454 476 2.75e-3 SMART
low complexity region 519 551 N/A INTRINSIC
low complexity region 566 593 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 743 765 N/A INTRINSIC
ZnF_C2H2 786 808 1.41e0 SMART
ZnF_C2H2 814 836 4.24e-4 SMART
ZnF_C2H2 844 867 3.07e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109887
AA Change: H676Y
SMART Domains Protein: ENSMUSP00000105513
Gene: ENSMUSG00000048251
AA Change: H676Y

DomainStartEndE-ValueType
ZnF_C2H2 27 50 1.16e-1 SMART
low complexity region 117 136 N/A INTRINSIC
ZnF_C2H2 232 254 6.23e-2 SMART
ZnF_C2H2 260 282 2.75e-3 SMART
low complexity region 325 357 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 549 571 N/A INTRINSIC
ZnF_C2H2 592 614 1.41e0 SMART
ZnF_C2H2 620 642 4.24e-4 SMART
ZnF_C2H2 650 673 3.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109891
AA Change: H798Y

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105517
Gene: ENSMUSG00000048251
AA Change: H798Y

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Pfam:zf-C2H2_6 55 83 3.9e-9 PFAM
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 149 172 1.16e-1 SMART
low complexity region 239 258 N/A INTRINSIC
ZnF_C2H2 354 376 6.23e-2 SMART
ZnF_C2H2 382 404 2.75e-3 SMART
low complexity region 447 479 N/A INTRINSIC
low complexity region 494 521 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
ZnF_C2H2 714 736 1.41e0 SMART
ZnF_C2H2 742 764 4.24e-4 SMART
ZnF_C2H2 772 795 3.07e-1 SMART
Meta Mutation Damage Score 0.1430 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. Although the specific function of this gene has not been determined, the encoded protein is known to be a transcriptional repressor, and is regulated by the NURD nucleosome remodeling and histone deacetylase complex. Four alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Animals homozygous for a mutation of this gene are born with open eyes, exhibit abnormalities of the thymus, and die within 1 day after birth. Mice heterozygous for a hypomorphic allele and a knock-out allele exhibit lethality at weaning due to maxillaryincisor hyperplasia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Bcl11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Bcl11b APN 12 107965815 missense possibly damaging 0.46
IGL02492:Bcl11b APN 12 107915686 missense probably damaging 0.98
IGL02559:Bcl11b APN 12 107915394 utr 3 prime probably benign
IGL02950:Bcl11b APN 12 107989806 missense probably benign 0.00
Acidophilus UTSW 12 107917303 missense probably damaging 1.00
Activia UTSW 12 108003143 start codon destroyed probably benign 0.21
hyphae UTSW 12 107916001 missense probably benign 0.01
R0055:Bcl11b UTSW 12 107965777 missense probably benign 0.02
R0762:Bcl11b UTSW 12 107965663 intron probably benign
R1549:Bcl11b UTSW 12 107917163 missense probably damaging 0.97
R1682:Bcl11b UTSW 12 107916649 missense probably damaging 1.00
R2269:Bcl11b UTSW 12 107915651 missense possibly damaging 0.71
R3053:Bcl11b UTSW 12 107916001 missense probably benign 0.01
R4094:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4095:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4155:Bcl11b UTSW 12 107917425 splice site probably null
R4156:Bcl11b UTSW 12 107917425 splice site probably null
R4157:Bcl11b UTSW 12 107917425 splice site probably null
R4611:Bcl11b UTSW 12 107916530 missense probably damaging 0.97
R4900:Bcl11b UTSW 12 107989698 missense probably damaging 1.00
R4906:Bcl11b UTSW 12 107916709 missense probably damaging 1.00
R4982:Bcl11b UTSW 12 107965772 nonsense probably null
R5108:Bcl11b UTSW 12 107965726 missense probably benign 0.04
R5190:Bcl11b UTSW 12 107989716 missense probably damaging 1.00
R6380:Bcl11b UTSW 12 108003101 missense probably benign 0.20
R6423:Bcl11b UTSW 12 107915419 missense possibly damaging 0.82
R6792:Bcl11b UTSW 12 107989734 missense probably damaging 1.00
R7026:Bcl11b UTSW 12 107916592 missense probably damaging 0.99
R7074:Bcl11b UTSW 12 107989507 missense probably benign 0.01
R7371:Bcl11b UTSW 12 107989491 missense probably damaging 1.00
R7454:Bcl11b UTSW 12 107916208 missense possibly damaging 0.93
R7590:Bcl11b UTSW 12 108003143 start codon destroyed probably benign 0.21
R8005:Bcl11b UTSW 12 107916197 missense probably benign
R8131:Bcl11b UTSW 12 107965708 missense probably benign
R8783:Bcl11b UTSW 12 107917303 missense probably damaging 1.00
R8914:Bcl11b UTSW 12 107916904 missense probably damaging 0.98
R9281:Bcl11b UTSW 12 107915998 missense possibly damaging 0.96
R9566:Bcl11b UTSW 12 107915525 missense possibly damaging 0.93
X0018:Bcl11b UTSW 12 107989689 missense probably damaging 1.00
X0021:Bcl11b UTSW 12 107916877 missense probably damaging 0.97
Z1177:Bcl11b UTSW 12 107989740 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACACAGGTTAGGCTGGAC -3'
(R):5'- ACTGTAGCAACCTGACGGTG -3'

Sequencing Primer
(F):5'- GACTGCCGCCTCCCTGG -3'
(R):5'- CGGAGGAGCCACACCGG -3'
Posted On 2014-12-04