Mutagenetix > Incidental Mutation

Incidental Mutation 'R2495:Bcl11b'

251006

Institutional Source

Beutler Lab

Gene Symbol

Bcl11b

Ensembl Gene

ENSMUSG00000048251

Gene Name

B cell leukemia/lymphoma 11B

Synonyms

9130430L19Rik, CTIP2, B630002E05Rik, COUP-TF interacting protein 2, Rit1

MMRRC Submission

040409-MU

Accession Numbers

Genbank: NM_001079883; MGI: 1929913

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2495 (G1)

Quality Score

127

Status

Validated

Chromosome

Chromosomal Location

107910403-108003602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 107915447 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 798 (H798Y)

Ref Sequence

ENSEMBL: ENSMUSP00000105517 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066060] [ENSMUST00000109887] [ENSMUST00000109891]

AlphaFold

Q99PV8

Predicted Effect

probably benign
Transcript: ENSMUST00000066060
AA Change: H870Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000068258
Gene: ENSMUSG00000048251
AA Change: H870Y

Domain	Start	End	E-Value	Type
low complexity region	29	40	N/A	INTRINSIC
Blast:ZnF_C2H2	56	81	5e-10	BLAST
low complexity region	95	113	N/A	INTRINSIC
ZnF_C2H2	221	244	1.16e-1	SMART
low complexity region	311	330	N/A	INTRINSIC
ZnF_C2H2	426	448	6.23e-2	SMART
ZnF_C2H2	454	476	2.75e-3	SMART
low complexity region	519	551	N/A	INTRINSIC
low complexity region	566	593	N/A	INTRINSIC
low complexity region	617	636	N/A	INTRINSIC
low complexity region	639	656	N/A	INTRINSIC
low complexity region	659	675	N/A	INTRINSIC
low complexity region	743	765	N/A	INTRINSIC
ZnF_C2H2	786	808	1.41e0	SMART
ZnF_C2H2	814	836	4.24e-4	SMART
ZnF_C2H2	844	867	3.07e-1	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000109887
AA Change: H676Y

SMART Domains

Protein: ENSMUSP00000105513
Gene: ENSMUSG00000048251
AA Change: H676Y

Domain	Start	End	E-Value	Type
ZnF_C2H2	27	50	1.16e-1	SMART
low complexity region	117	136	N/A	INTRINSIC
ZnF_C2H2	232	254	6.23e-2	SMART
ZnF_C2H2	260	282	2.75e-3	SMART
low complexity region	325	357	N/A	INTRINSIC
low complexity region	372	399	N/A	INTRINSIC
low complexity region	423	442	N/A	INTRINSIC
low complexity region	445	462	N/A	INTRINSIC
low complexity region	465	481	N/A	INTRINSIC
low complexity region	549	571	N/A	INTRINSIC
ZnF_C2H2	592	614	1.41e0	SMART
ZnF_C2H2	620	642	4.24e-4	SMART
ZnF_C2H2	650	673	3.07e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109891
AA Change: H798Y

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105517
Gene: ENSMUSG00000048251
AA Change: H798Y

Domain	Start	End	E-Value	Type
low complexity region	29	40	N/A	INTRINSIC
Pfam:zf-C2H2_6	55	83	3.9e-9	PFAM
low complexity region	95	113	N/A	INTRINSIC
ZnF_C2H2	149	172	1.16e-1	SMART
low complexity region	239	258	N/A	INTRINSIC
ZnF_C2H2	354	376	6.23e-2	SMART
ZnF_C2H2	382	404	2.75e-3	SMART
low complexity region	447	479	N/A	INTRINSIC
low complexity region	494	521	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	567	584	N/A	INTRINSIC
low complexity region	587	603	N/A	INTRINSIC
low complexity region	671	693	N/A	INTRINSIC
ZnF_C2H2	714	736	1.41e0	SMART
ZnF_C2H2	742	764	4.24e-4	SMART
ZnF_C2H2	772	795	3.07e-1	SMART

Meta Mutation Damage Score

0.1430

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. Although the specific function of this gene has not been determined, the encoded protein is known to be a transcriptional repressor, and is regulated by the NURD nucleosome remodeling and histone deacetylase complex. Four alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Animals homozygous for a mutation of this gene are born with open eyes, exhibit abnormalities of the thymus, and die within 1 day after birth. Mice heterozygous for a hypomorphic allele and a knock-out allele exhibit lethality at weaning due to maxillaryincisor hyperplasia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	C	3: 36,481,960	F125S	unknown	Het
Abhd17c	C	T	7: 84,110,676	W290*	probably null	Het
Acsl5	A	T	19: 55,293,599	K536*	probably null	Het
Adamts14	A	T	10: 61,198,970		probably null	Het
Agbl3	A	G	6: 34,846,764	H788R	probably damaging	Het
Agrp	T	C	8: 105,566,776	N126D	possibly damaging	Het
Ambn	T	C	5: 88,467,804	I349T	probably benign	Het
Ank1	T	C	8: 23,132,264	W1610R	probably damaging	Het
Aox3	T	C	1: 58,188,408	L1224P	probably damaging	Het
Arhgef28	A	T	13: 98,029,373		probably benign	Het
Capn11	T	A	17: 45,638,763	M426L	probably damaging	Het
Cep95	A	G	11: 106,809,282	K290E	possibly damaging	Het
Cic	A	G	7: 25,291,776		probably benign	Het
Cnbd1	A	T	4: 18,860,579	M389K	probably damaging	Het
Cnksr1	A	T	4: 134,232,162	L387Q	probably benign	Het
Cntrob	G	T	11: 69,322,923	P14T	probably damaging	Het
Crmp1	G	A	5: 37,246,097		probably null	Het
Dido1	A	G	2: 180,689,388	V89A	probably benign	Het
Dnah7a	T	A	1: 53,605,881	I999F	probably damaging	Het
Dsp	T	A	13: 38,193,477	L1746Q	possibly damaging	Het
Dst	T	C	1: 34,199,373	S3897P	probably damaging	Het
Fbxo10	A	G	4: 45,040,545	F887L	probably benign	Het
Gm21961	T	A	15: 65,014,873	H11L	unknown	Het
Gm4559	A	T	7: 142,273,820	C182S	unknown	Het
Gm5724	C	A	6: 141,765,777	M69I	probably benign	Het
Golga3	T	A	5: 110,207,596	S939T	probably damaging	Het
Got2	A	G	8: 95,888,290	S6P	possibly damaging	Het
Gpatch8	A	T	11: 102,478,481	H1410Q	probably damaging	Het
Gpx5	T	A	13: 21,291,440	T39S	probably benign	Het
Grin2b	T	C	6: 135,733,182	Y1122C	probably damaging	Het
Gsn	A	C	2: 35,303,193	N538T	probably damaging	Het
Helz2	A	G	2: 181,232,912	S1930P	probably damaging	Het
Krt6b	A	T	15: 101,678,322	F286Y	probably damaging	Het
Lrriq1	G	A	10: 103,202,381	R854C	probably damaging	Het
Mipol1	A	T	12: 57,460,990		probably benign	Het
Mmp19	A	G	10: 128,790,950		probably benign	Het
Msc	T	G	1: 14,755,249	Y167S	probably benign	Het
Mycbp2	T	G	14: 103,200,118	K2103Q	probably damaging	Het
Myh11	C	A	16: 14,205,557	D1586Y	probably damaging	Het
Nol6	A	T	4: 41,118,427	D791E	probably damaging	Het
Pcm1	A	G	8: 41,293,579	T1272A	probably benign	Het
Phgdh	A	G	3: 98,339,789	L15P	probably damaging	Het
Ptprk	A	T	10: 28,475,078		probably benign	Het
Ralgapa2	G	T	2: 146,361,400	D1091E	possibly damaging	Het
Rbbp8nl	C	A	2: 180,279,102	K496N	probably null	Het
Rbm26	T	C	14: 105,151,312		probably benign	Het
Rfx6	A	C	10: 51,726,675		probably benign	Het
Rras	G	A	7: 45,018,064	G17R	probably damaging	Het
Shisa6	G	A	11: 66,217,633	P473S	probably damaging	Het
Slc9a3	A	G	13: 74,158,703	K316E	probably damaging	Het
Spata31d1a	A	G	13: 59,701,993	S774P	possibly damaging	Het
Spsb4	T	C	9: 96,995,787	Y161C	probably damaging	Het
Taf3	G	T	2: 9,952,833	N174K	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Trnt1	T	A	6: 106,773,369	V78E	possibly damaging	Het
Ubox5	A	T	2: 130,599,521	C415*	probably null	Het
Ucn2	C	T	9: 108,986,409	P80S	possibly damaging	Het
Vmn2r10	G	A	5: 108,996,095	T663I	probably damaging	Het
Wdfy1	A	T	1: 79,707,505	F337L	probably null	Het
Zfp287	A	T	11: 62,714,633	C483S	probably damaging	Het
Zyg11b	A	G	4: 108,244,724		probably null	Het

Other mutations in Bcl11b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Bcl11b	APN	12	107965815	missense	possibly damaging	0.46
IGL02492:Bcl11b	APN	12	107915686	missense	probably damaging	0.98
IGL02559:Bcl11b	APN	12	107915394	utr 3 prime	probably benign
IGL02950:Bcl11b	APN	12	107989806	missense	probably benign	0.00
Acidophilus	UTSW	12	107917303	missense	probably damaging	1.00
Activia	UTSW	12	108003143	start codon destroyed	probably benign	0.21
hyphae	UTSW	12	107916001	missense	probably benign	0.01
R0055:Bcl11b	UTSW	12	107965777	missense	probably benign	0.02
R0762:Bcl11b	UTSW	12	107965663	intron	probably benign
R1549:Bcl11b	UTSW	12	107917163	missense	probably damaging	0.97
R1682:Bcl11b	UTSW	12	107916649	missense	probably damaging	1.00
R2269:Bcl11b	UTSW	12	107915651	missense	possibly damaging	0.71
R3053:Bcl11b	UTSW	12	107916001	missense	probably benign	0.01
R4094:Bcl11b	UTSW	12	107916835	missense	probably damaging	1.00
R4095:Bcl11b	UTSW	12	107916835	missense	probably damaging	1.00
R4155:Bcl11b	UTSW	12	107917425	splice site	probably null
R4156:Bcl11b	UTSW	12	107917425	splice site	probably null
R4157:Bcl11b	UTSW	12	107917425	splice site	probably null
R4611:Bcl11b	UTSW	12	107916530	missense	probably damaging	0.97
R4900:Bcl11b	UTSW	12	107989698	missense	probably damaging	1.00
R4906:Bcl11b	UTSW	12	107916709	missense	probably damaging	1.00
R4982:Bcl11b	UTSW	12	107965772	nonsense	probably null
R5108:Bcl11b	UTSW	12	107965726	missense	probably benign	0.04
R5190:Bcl11b	UTSW	12	107989716	missense	probably damaging	1.00
R6380:Bcl11b	UTSW	12	108003101	missense	probably benign	0.20
R6423:Bcl11b	UTSW	12	107915419	missense	possibly damaging	0.82
R6792:Bcl11b	UTSW	12	107989734	missense	probably damaging	1.00
R7026:Bcl11b	UTSW	12	107916592	missense	probably damaging	0.99
R7074:Bcl11b	UTSW	12	107989507	missense	probably benign	0.01
R7371:Bcl11b	UTSW	12	107989491	missense	probably damaging	1.00
R7454:Bcl11b	UTSW	12	107916208	missense	possibly damaging	0.93
R7590:Bcl11b	UTSW	12	108003143	start codon destroyed	probably benign	0.21
R8005:Bcl11b	UTSW	12	107916197	missense	probably benign
R8131:Bcl11b	UTSW	12	107965708	missense	probably benign
R8783:Bcl11b	UTSW	12	107917303	missense	probably damaging	1.00
R8914:Bcl11b	UTSW	12	107916904	missense	probably damaging	0.98
R9281:Bcl11b	UTSW	12	107915998	missense	possibly damaging	0.96
R9566:Bcl11b	UTSW	12	107915525	missense	possibly damaging	0.93
X0018:Bcl11b	UTSW	12	107989689	missense	probably damaging	1.00
X0021:Bcl11b	UTSW	12	107916877	missense	probably damaging	0.97
Z1177:Bcl11b	UTSW	12	107989740	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGACACAGGTTAGGCTGGAC -3'
(R):5'- ACTGTAGCAACCTGACGGTG -3'

Sequencing Primer
(F):5'- GACTGCCGCCTCCCTGG -3'
(R):5'- CGGAGGAGCCACACCGG -3'

Posted On

2014-12-04