Incidental Mutation 'R2495:Krt6b'
ID 251018
Institutional Source Beutler Lab
Gene Symbol Krt6b
Ensembl Gene ENSMUSG00000023041
Gene Name keratin 6B
Synonyms mK6[b], Krt2-6b
MMRRC Submission 040409-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R2495 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 101584458-101588722 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101586757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 286 (F286Y)
Ref Sequence ENSEMBL: ENSMUSP00000023786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023786]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023786
AA Change: F286Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023786
Gene: ENSMUSG00000023041
AA Change: F286Y

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 1.3e-36 PFAM
Filament 151 464 2.79e-175 SMART
low complexity region 483 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198940
Meta Mutation Damage Score 0.3374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,536,109 (GRCm39) F125S unknown Het
Abhd17c C T 7: 83,759,884 (GRCm39) W290* probably null Het
Acsl5 A T 19: 55,282,031 (GRCm39) K536* probably null Het
Adamts14 A T 10: 61,034,749 (GRCm39) probably null Het
Agbl3 A G 6: 34,823,699 (GRCm39) H788R probably damaging Het
Agrp T C 8: 106,293,408 (GRCm39) N126D possibly damaging Het
Ambn T C 5: 88,615,663 (GRCm39) I349T probably benign Het
Ank1 T C 8: 23,622,280 (GRCm39) W1610R probably damaging Het
Aox3 T C 1: 58,227,567 (GRCm39) L1224P probably damaging Het
Arhgef28 A T 13: 98,165,881 (GRCm39) probably benign Het
Bcl11b G A 12: 107,881,706 (GRCm39) H798Y possibly damaging Het
Capn11 T A 17: 45,949,689 (GRCm39) M426L probably damaging Het
Cep95 A G 11: 106,700,108 (GRCm39) K290E possibly damaging Het
Cic A G 7: 24,991,201 (GRCm39) probably benign Het
Cnbd1 A T 4: 18,860,579 (GRCm39) M389K probably damaging Het
Cnksr1 A T 4: 133,959,473 (GRCm39) L387Q probably benign Het
Cntrob G T 11: 69,213,749 (GRCm39) P14T probably damaging Het
Crmp1 G A 5: 37,403,441 (GRCm39) probably null Het
Dido1 A G 2: 180,331,181 (GRCm39) V89A probably benign Het
Dnah7a T A 1: 53,645,040 (GRCm39) I999F probably damaging Het
Dsp T A 13: 38,377,453 (GRCm39) L1746Q possibly damaging Het
Dst T C 1: 34,238,454 (GRCm39) S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 (GRCm39) F887L probably benign Het
Gm21961 T A 15: 64,886,722 (GRCm39) H11L unknown Het
Gm4559 A T 7: 141,827,557 (GRCm39) C182S unknown Het
Golga3 T A 5: 110,355,462 (GRCm39) S939T probably damaging Het
Got2 A G 8: 96,614,918 (GRCm39) S6P possibly damaging Het
Gpatch8 A T 11: 102,369,307 (GRCm39) H1410Q probably damaging Het
Gpx5 T A 13: 21,475,610 (GRCm39) T39S probably benign Het
Grin2b T C 6: 135,710,180 (GRCm39) Y1122C probably damaging Het
Gsn A C 2: 35,193,205 (GRCm39) N538T probably damaging Het
Helz2 A G 2: 180,874,705 (GRCm39) S1930P probably damaging Het
Lrriq1 G A 10: 103,038,242 (GRCm39) R854C probably damaging Het
Mipol1 A T 12: 57,507,776 (GRCm39) probably benign Het
Mmp19 A G 10: 128,626,819 (GRCm39) probably benign Het
Msc T G 1: 14,825,473 (GRCm39) Y167S probably benign Het
Mycbp2 T G 14: 103,437,554 (GRCm39) K2103Q probably damaging Het
Myh11 C A 16: 14,023,421 (GRCm39) D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 (GRCm39) D791E probably damaging Het
Pcm1 A G 8: 41,746,616 (GRCm39) T1272A probably benign Het
Phgdh A G 3: 98,247,105 (GRCm39) L15P probably damaging Het
Ptprk A T 10: 28,351,074 (GRCm39) probably benign Het
Ralgapa2 G T 2: 146,203,320 (GRCm39) D1091E possibly damaging Het
Rbbp8nl C A 2: 179,920,895 (GRCm39) K496N probably null Het
Rbm26 T C 14: 105,388,748 (GRCm39) probably benign Het
Rfx6 A C 10: 51,602,771 (GRCm39) probably benign Het
Rras G A 7: 44,667,488 (GRCm39) G17R probably damaging Het
Shisa6 G A 11: 66,108,459 (GRCm39) P473S probably damaging Het
Slc9a3 A G 13: 74,306,822 (GRCm39) K316E probably damaging Het
Slco1a7 C A 6: 141,711,503 (GRCm39) M69I probably benign Het
Spata31d1a A G 13: 59,849,807 (GRCm39) S774P possibly damaging Het
Spsb4 T C 9: 96,877,840 (GRCm39) Y161C probably damaging Het
Taf3 G T 2: 9,957,644 (GRCm39) N174K probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Trnt1 T A 6: 106,750,330 (GRCm39) V78E possibly damaging Het
Ubox5 A T 2: 130,441,441 (GRCm39) C415* probably null Het
Ucn2 C T 9: 108,815,477 (GRCm39) P80S possibly damaging Het
Vmn2r10 G A 5: 109,143,961 (GRCm39) T663I probably damaging Het
Wdfy1 A T 1: 79,685,222 (GRCm39) F337L probably null Het
Zfp287 A T 11: 62,605,459 (GRCm39) C483S probably damaging Het
Zyg11b A G 4: 108,101,921 (GRCm39) probably null Het
Other mutations in Krt6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Krt6b APN 15 101,588,267 (GRCm39) missense probably benign 0.22
IGL01653:Krt6b APN 15 101,587,549 (GRCm39) missense probably damaging 1.00
IGL01900:Krt6b APN 15 101,585,981 (GRCm39) missense possibly damaging 0.45
IGL03187:Krt6b APN 15 101,588,392 (GRCm39) missense probably benign
R0511:Krt6b UTSW 15 101,586,042 (GRCm39) splice site probably benign
R0788:Krt6b UTSW 15 101,585,954 (GRCm39) missense probably damaging 0.96
R1370:Krt6b UTSW 15 101,585,987 (GRCm39) missense probably damaging 0.96
R1481:Krt6b UTSW 15 101,586,809 (GRCm39) missense probably benign 0.05
R2007:Krt6b UTSW 15 101,586,562 (GRCm39) missense probably damaging 1.00
R2112:Krt6b UTSW 15 101,586,999 (GRCm39) missense possibly damaging 0.48
R2166:Krt6b UTSW 15 101,587,050 (GRCm39) critical splice acceptor site probably null
R2227:Krt6b UTSW 15 101,587,557 (GRCm39) missense probably damaging 0.96
R2496:Krt6b UTSW 15 101,588,216 (GRCm39) missense probably damaging 1.00
R4726:Krt6b UTSW 15 101,586,520 (GRCm39) missense probably damaging 0.98
R4969:Krt6b UTSW 15 101,588,460 (GRCm39) missense possibly damaging 0.71
R6301:Krt6b UTSW 15 101,587,386 (GRCm39) missense probably damaging 1.00
R6646:Krt6b UTSW 15 101,585,649 (GRCm39) missense probably damaging 0.98
R7232:Krt6b UTSW 15 101,586,577 (GRCm39) missense probably damaging 1.00
R7406:Krt6b UTSW 15 101,587,513 (GRCm39) missense probably benign 0.04
R7414:Krt6b UTSW 15 101,587,449 (GRCm39) missense probably benign 0.05
R7849:Krt6b UTSW 15 101,587,009 (GRCm39) missense probably damaging 1.00
R8110:Krt6b UTSW 15 101,588,577 (GRCm39) missense probably damaging 0.96
R8348:Krt6b UTSW 15 101,586,455 (GRCm39) missense probably damaging 1.00
R8448:Krt6b UTSW 15 101,586,455 (GRCm39) missense probably damaging 1.00
R8736:Krt6b UTSW 15 101,587,047 (GRCm39) missense probably damaging 1.00
R9466:Krt6b UTSW 15 101,586,027 (GRCm39) missense probably damaging 1.00
R9633:Krt6b UTSW 15 101,586,996 (GRCm39) missense probably benign 0.00
R9720:Krt6b UTSW 15 101,588,226 (GRCm39) missense probably benign 0.40
Z1177:Krt6b UTSW 15 101,586,767 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTGTCCATGGAGAGGACC -3'
(R):5'- GGCATAAATGGTCTTGCCTGTC -3'

Sequencing Primer
(F):5'- CATGGAGAGGACCACAGATGTGTC -3'
(R):5'- TGTCCAGTCCATTCCAGAGAAATCG -3'
Posted On 2014-12-04