Incidental Mutation 'R2495:Acsl5'
ID251024
Institutional Source Beutler Lab
Gene Symbol Acsl5
Ensembl Gene ENSMUSG00000024981
Gene Nameacyl-CoA synthetase long-chain family member 5
SynonymsFacl5, 1700030F05Rik
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location55251938-55297720 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 55293599 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 536 (K536*)
Ref Sequence ENSEMBL: ENSMUSP00000046585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043150] [ENSMUST00000076891] [ENSMUST00000224897] [ENSMUST00000225495] [ENSMUST00000225963] [ENSMUST00000226103]
Predicted Effect probably null
Transcript: ENSMUST00000043150
AA Change: K536*
SMART Domains Protein: ENSMUSP00000046585
Gene: ENSMUSG00000024981
AA Change: K536*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:AMP-binding 82 548 2.7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076891
SMART Domains Protein: ENSMUSP00000076157
Gene: ENSMUSG00000024982

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:zf-DHHC 94 244 3.2e-38 PFAM
SH3 316 397 5.84e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224414
Predicted Effect probably benign
Transcript: ENSMUST00000224897
Predicted Effect probably benign
Transcript: ENSMUST00000225495
Predicted Effect probably benign
Transcript: ENSMUST00000225963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226019
Predicted Effect probably benign
Transcript: ENSMUST00000226103
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in uterus and spleen, and in trace amounts in normal brain, but has markedly increased levels in malignant gliomas. This gene functions in mediating fatty acid-induced glioma cell growth. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit decreased mean bone mineral content and density measurements when compared with controls. A notably decreased mean platelet count is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Acsl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Acsl5 APN 19 55272833 missense probably benign 0.02
IGL02792:Acsl5 APN 19 55293731 critical splice donor site probably null
lyrebird UTSW 19 55272819 nonsense probably null
paradise UTSW 19 55278183 missense
IGL02796:Acsl5 UTSW 19 55278169 nonsense probably null
R0206:Acsl5 UTSW 19 55280569 missense probably benign
R0400:Acsl5 UTSW 19 55293711 missense probably damaging 0.99
R0418:Acsl5 UTSW 19 55272806 missense probably benign 0.16
R0571:Acsl5 UTSW 19 55288911 intron probably benign
R0626:Acsl5 UTSW 19 55284472 missense probably benign 0.00
R0792:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1144:Acsl5 UTSW 19 55291843 missense probably damaging 1.00
R1477:Acsl5 UTSW 19 55291472 missense probably benign 0.23
R1522:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1927:Acsl5 UTSW 19 55278154 missense probably benign 0.37
R4153:Acsl5 UTSW 19 55281463 missense probably benign 0.23
R4570:Acsl5 UTSW 19 55291774 missense probably damaging 0.99
R4721:Acsl5 UTSW 19 55280530 missense probably benign 0.00
R4834:Acsl5 UTSW 19 55280559 missense probably benign 0.00
R5270:Acsl5 UTSW 19 55294218 missense possibly damaging 0.50
R5360:Acsl5 UTSW 19 55291160 nonsense probably null
R5436:Acsl5 UTSW 19 55279565 critical splice donor site probably null
R5458:Acsl5 UTSW 19 55294230 missense probably damaging 1.00
R5479:Acsl5 UTSW 19 55280462 missense probably damaging 1.00
R5812:Acsl5 UTSW 19 55294836 missense probably benign 0.01
R6232:Acsl5 UTSW 19 55280501 missense possibly damaging 0.69
R6821:Acsl5 UTSW 19 55288836 missense probably benign 0.03
R6874:Acsl5 UTSW 19 55291863 missense probably damaging 1.00
R7030:Acsl5 UTSW 19 55272819 nonsense probably null
R7156:Acsl5 UTSW 19 55268828 splice site probably null
R7293:Acsl5 UTSW 19 55291210 missense probably damaging 0.98
R7543:Acsl5 UTSW 19 55278183 missense
R7728:Acsl5 UTSW 19 55287853 nonsense probably null
R7977:Acsl5 UTSW 19 55277973 critical splice donor site probably null
R7987:Acsl5 UTSW 19 55277973 critical splice donor site probably null
R8221:Acsl5 UTSW 19 55268830 critical splice donor site probably null
X0013:Acsl5 UTSW 19 55293664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGGCTTTCTACAGACAGG -3'
(R):5'- GGGGCATCTTATCTGAACCCAC -3'

Sequencing Primer
(F):5'- TCTACAGACAGGCTTTGTGGAAG -3'
(R):5'- CCACCTATACAAATGCCTTATATGG -3'
Posted On2014-12-04