Incidental Mutation 'R2497:Phf3'
ID251025
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene NamePHD finger protein 3
SynonymsAU020177, 2310061N19Rik
MMRRC Submission 040411-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2497 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location30802339-30873921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30830014 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 651 (R651L)
Ref Sequence ENSEMBL: ENSMUSP00000139610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000188780] [ENSMUST00000191064]
Predicted Effect probably damaging
Transcript: ENSMUST00000088310
AA Change: R651L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: R651L

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186105
Predicted Effect probably damaging
Transcript: ENSMUST00000186733
AA Change: R651L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: R651L

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187600
Predicted Effect probably benign
Transcript: ENSMUST00000188780
SMART Domains Protein: ENSMUSP00000140935
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
low complexity region 158 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195437
Meta Mutation Damage Score 0.1696 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,267 probably benign Het
Acox2 A G 14: 8,251,612 V295A probably benign Het
Agrn T C 4: 156,173,811 E959G probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arhgap39 C A 15: 76,725,385 V1025L probably damaging Het
Atg4d C T 9: 21,273,386 R459* probably null Het
Atp11b A G 3: 35,855,145 S1163G probably damaging Het
Atp13a5 G T 16: 29,339,071 S173* probably null Het
Atp6v1g2 T A 17: 35,236,786 I8N probably damaging Het
Ccdc77 C T 6: 120,325,472 G430R possibly damaging Het
Cdc34b A G 11: 94,742,381 T136A probably benign Het
Cdkal1 A G 13: 29,474,541 S23P unknown Het
Cdkl2 T A 5: 92,008,998 H566L probably benign Het
Cers6 T C 2: 69,071,446 probably benign Het
Clspn A G 4: 126,572,347 T557A possibly damaging Het
Cmya5 T C 13: 93,098,005 T192A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah17 T G 11: 118,087,024 probably null Het
Dnah8 C T 17: 30,741,365 Q2239* probably null Het
Dscaml1 T C 9: 45,745,078 V1572A probably benign Het
Elfn2 C G 15: 78,674,264 E28Q probably damaging Het
Enam T A 5: 88,502,694 N687K probably benign Het
Flywch1 G A 17: 23,755,711 R652W probably benign Het
Gm5612 T C 9: 18,427,679 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Mmp3 A G 9: 7,450,131 T288A probably benign Het
Mtmr4 T A 11: 87,600,823 F168L probably damaging Het
Myo1d T A 11: 80,674,821 N393Y probably damaging Het
Nacc2 A T 2: 26,089,568 Y285* probably null Het
Nf1 G T 11: 79,443,884 G844V probably damaging Het
Nox4 T A 7: 87,295,876 Y113* probably null Het
Pcdha3 T C 18: 36,947,503 C433R probably benign Het
Pde6c A G 19: 38,153,694 I358V probably damaging Het
Pdgfrb A T 18: 61,078,628 D819V possibly damaging Het
Prrx1 A G 1: 163,248,265 V244A possibly damaging Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rab27a T C 9: 73,084,981 L97P probably damaging Het
Rnf20 G A 4: 49,652,676 probably null Het
Sdad1 T C 5: 92,300,099 N259S probably benign Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc1a4 T C 11: 20,332,620 probably benign Het
Smyd2 T A 1: 189,885,337 N300I possibly damaging Het
Snd1 A G 6: 28,888,079 I875V probably benign Het
Ssh1 T C 5: 113,958,858 N174S probably damaging Het
Tanc2 T C 11: 105,673,493 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tpcn1 C T 5: 120,538,998 probably null Het
Unc45b A T 11: 82,936,443 I699F probably damaging Het
Uspl1 C T 5: 149,187,854 P27L probably damaging Het
Wdr66 T C 5: 123,283,369 V98A probably damaging Het
Ylpm1 C G 12: 84,996,761 P91R probably damaging Het
Zdhhc23 G A 16: 43,973,915 T132M probably damaging Het
Zfp148 T C 16: 33,496,385 Y434H probably damaging Het
Zhx2 T C 15: 57,823,155 V640A possibly damaging Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30811847 missense probably damaging 0.99
IGL00704:Phf3 APN 1 30804838 missense probably benign
IGL01147:Phf3 APN 1 30804169 missense probably damaging 1.00
IGL01360:Phf3 APN 1 30808728 missense probably damaging 1.00
IGL01376:Phf3 APN 1 30830485 missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30804305 nonsense probably null
IGL01830:Phf3 APN 1 30814067 nonsense probably null
IGL02108:Phf3 APN 1 30829951 missense probably damaging 1.00
IGL02156:Phf3 APN 1 30808778 missense probably damaging 1.00
IGL02576:Phf3 APN 1 30830036 missense probably benign 0.01
IGL03031:Phf3 APN 1 30804653 missense probably benign 0.00
IGL03334:Phf3 APN 1 30805729 missense probably damaging 0.99
IGL03411:Phf3 APN 1 30804401 missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30805023 utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30816541 missense probably damaging 1.00
R0037:Phf3 UTSW 1 30804918 missense probably benign 0.03
R0052:Phf3 UTSW 1 30808767 missense probably damaging 1.00
R0114:Phf3 UTSW 1 30805443 missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0225:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0715:Phf3 UTSW 1 30811838 missense probably damaging 1.00
R0835:Phf3 UTSW 1 30830551 missense probably benign 0.02
R0848:Phf3 UTSW 1 30863172 missense probably damaging 1.00
R1473:Phf3 UTSW 1 30805940 missense probably damaging 1.00
R1522:Phf3 UTSW 1 30805648 missense probably benign 0.05
R1549:Phf3 UTSW 1 30804842 missense probably benign 0.00
R1555:Phf3 UTSW 1 30805877 missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30811942 missense probably damaging 1.00
R1789:Phf3 UTSW 1 30806206 missense probably damaging 1.00
R1875:Phf3 UTSW 1 30830623 missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R1957:Phf3 UTSW 1 30831520 missense probably damaging 1.00
R2019:Phf3 UTSW 1 30811847 missense probably damaging 0.99
R2259:Phf3 UTSW 1 30804343 missense probably benign 0.20
R2305:Phf3 UTSW 1 30805475 nonsense probably null
R2345:Phf3 UTSW 1 30805351 nonsense probably null
R2424:Phf3 UTSW 1 30806349 missense probably damaging 1.00
R2504:Phf3 UTSW 1 30810789 missense probably damaging 1.00
R3522:Phf3 UTSW 1 30805603 missense probably damaging 1.00
R3816:Phf3 UTSW 1 30805753 missense probably damaging 1.00
R4152:Phf3 UTSW 1 30831458 missense probably benign 0.13
R4403:Phf3 UTSW 1 30804409 missense probably damaging 1.00
R4658:Phf3 UTSW 1 30863088 missense probably damaging 1.00
R4663:Phf3 UTSW 1 30821215 missense probably damaging 1.00
R4669:Phf3 UTSW 1 30829946 missense probably damaging 1.00
R4706:Phf3 UTSW 1 30805606 missense probably damaging 1.00
R4757:Phf3 UTSW 1 30820827 missense probably damaging 1.00
R4766:Phf3 UTSW 1 30813939 unclassified probably benign
R4786:Phf3 UTSW 1 30816557 nonsense probably null
R5107:Phf3 UTSW 1 30831485 missense probably benign 0.03
R5155:Phf3 UTSW 1 30824376 missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30803806 missense probably damaging 1.00
R5823:Phf3 UTSW 1 30804683 missense probably damaging 1.00
R5944:Phf3 UTSW 1 30820704 missense probably damaging 1.00
R5979:Phf3 UTSW 1 30805746 missense probably damaging 1.00
R6007:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R6024:Phf3 UTSW 1 30863226 missense probably damaging 1.00
R6072:Phf3 UTSW 1 30830688 missense probably benign 0.08
R6533:Phf3 UTSW 1 30806318 missense probably damaging 1.00
R6649:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30804630 missense probably damaging 0.97
R6855:Phf3 UTSW 1 30820123 missense probably damaging 1.00
R6862:Phf3 UTSW 1 30813982 missense probably damaging 1.00
R6930:Phf3 UTSW 1 30811877 missense probably damaging 1.00
R7135:Phf3 UTSW 1 30831109 missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30813130 missense probably benign 0.01
R7352:Phf3 UTSW 1 30804326 missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30837158 missense probably damaging 0.96
R7549:Phf3 UTSW 1 30831475 missense probably benign 0.01
R7609:Phf3 UTSW 1 30805501 missense probably benign 0.05
R7720:Phf3 UTSW 1 30829857 missense probably damaging 1.00
R7745:Phf3 UTSW 1 30804224 missense probably damaging 1.00
Z1177:Phf3 UTSW 1 30804295 missense probably damaging 1.00
Z1177:Phf3 UTSW 1 30805051 missense unknown
Z1177:Phf3 UTSW 1 30811968 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGATCCCAATCCTCATTCTAGAAG -3'
(R):5'- TGGACACTTGGTGCATTCCAG -3'

Sequencing Primer
(F):5'- TCTAGAAGTTTCCCAATGTACACAC -3'
(R):5'- CTTGGTGCATTCCAGTCAAAAACAG -3'
Posted On2014-12-04