Incidental Mutation 'R2497:Cers6'
ID251032
Institutional Source Beutler Lab
Gene Symbol Cers6
Ensembl Gene ENSMUSG00000027035
Gene Nameceramide synthase 6
Synonymssimilar to TRH1, Lass6, CerS6, T1L, 4732462C07Rik
MMRRC Submission 040411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R2497 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68861441-69114282 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 69071446 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028426] [ENSMUST00000176018]
Predicted Effect probably benign
Transcript: ENSMUST00000028426
SMART Domains Protein: ENSMUSP00000028426
Gene: ENSMUSG00000027035

DomainStartEndE-ValueType
Blast:TLC 10 57 6e-7 BLAST
HOX 73 131 2.92e-2 SMART
TLC 130 331 1.21e-74 SMART
low complexity region 336 353 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175684
Predicted Effect probably benign
Transcript: ENSMUST00000176018
SMART Domains Protein: ENSMUSP00000135604
Gene: ENSMUSG00000027035

DomainStartEndE-ValueType
Blast:TLC 10 57 7e-7 BLAST
HOX 73 131 2.92e-2 SMART
TLC 130 331 1.21e-74 SMART
low complexity region 344 361 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit hind limb clasping, habituation deficit and altered lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,267 probably benign Het
Acox2 A G 14: 8,251,612 V295A probably benign Het
Agrn T C 4: 156,173,811 E959G probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arhgap39 C A 15: 76,725,385 V1025L probably damaging Het
Atg4d C T 9: 21,273,386 R459* probably null Het
Atp11b A G 3: 35,855,145 S1163G probably damaging Het
Atp13a5 G T 16: 29,339,071 S173* probably null Het
Atp6v1g2 T A 17: 35,236,786 I8N probably damaging Het
Ccdc77 C T 6: 120,325,472 G430R possibly damaging Het
Cdc34b A G 11: 94,742,381 T136A probably benign Het
Cdkal1 A G 13: 29,474,541 S23P unknown Het
Cdkl2 T A 5: 92,008,998 H566L probably benign Het
Clspn A G 4: 126,572,347 T557A possibly damaging Het
Cmya5 T C 13: 93,098,005 T192A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah17 T G 11: 118,087,024 probably null Het
Dnah8 C T 17: 30,741,365 Q2239* probably null Het
Dscaml1 T C 9: 45,745,078 V1572A probably benign Het
Elfn2 C G 15: 78,674,264 E28Q probably damaging Het
Enam T A 5: 88,502,694 N687K probably benign Het
Flywch1 G A 17: 23,755,711 R652W probably benign Het
Gm5612 T C 9: 18,427,679 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Mmp3 A G 9: 7,450,131 T288A probably benign Het
Mtmr4 T A 11: 87,600,823 F168L probably damaging Het
Myo1d T A 11: 80,674,821 N393Y probably damaging Het
Nacc2 A T 2: 26,089,568 Y285* probably null Het
Nf1 G T 11: 79,443,884 G844V probably damaging Het
Nox4 T A 7: 87,295,876 Y113* probably null Het
Pcdha3 T C 18: 36,947,503 C433R probably benign Het
Pde6c A G 19: 38,153,694 I358V probably damaging Het
Pdgfrb A T 18: 61,078,628 D819V possibly damaging Het
Phf3 C A 1: 30,830,014 R651L probably damaging Het
Prrx1 A G 1: 163,248,265 V244A possibly damaging Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rab27a T C 9: 73,084,981 L97P probably damaging Het
Rnf20 G A 4: 49,652,676 probably null Het
Sdad1 T C 5: 92,300,099 N259S probably benign Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc1a4 T C 11: 20,332,620 probably benign Het
Smyd2 T A 1: 189,885,337 N300I possibly damaging Het
Snd1 A G 6: 28,888,079 I875V probably benign Het
Ssh1 T C 5: 113,958,858 N174S probably damaging Het
Tanc2 T C 11: 105,673,493 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tpcn1 C T 5: 120,538,998 probably null Het
Unc45b A T 11: 82,936,443 I699F probably damaging Het
Uspl1 C T 5: 149,187,854 P27L probably damaging Het
Wdr66 T C 5: 123,283,369 V98A probably damaging Het
Ylpm1 C G 12: 84,996,761 P91R probably damaging Het
Zdhhc23 G A 16: 43,973,915 T132M probably damaging Het
Zfp148 T C 16: 33,496,385 Y434H probably damaging Het
Zhx2 T C 15: 57,823,155 V640A possibly damaging Het
Other mutations in Cers6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Cers6 APN 2 69068669 missense probably benign
IGL02897:Cers6 APN 2 68934533 nonsense probably null
IGL03299:Cers6 APN 2 68861784 missense probably benign 0.17
R0520:Cers6 UTSW 2 69105091 nonsense probably null
R1280:Cers6 UTSW 2 69068689 missense probably benign 0.06
R4843:Cers6 UTSW 2 69068659 missense probably benign 0.03
R4931:Cers6 UTSW 2 69105112 missense probably damaging 0.98
R5723:Cers6 UTSW 2 69108445 missense probably benign 0.03
R5973:Cers6 UTSW 2 69068625 splice site probably null
R6058:Cers6 UTSW 2 68861664 missense probably benign 0.12
R6453:Cers6 UTSW 2 69047169 missense probably benign 0.00
R6788:Cers6 UTSW 2 69108559 missense possibly damaging 0.95
R7493:Cers6 UTSW 2 68861807 critical splice donor site probably null
R8055:Cers6 UTSW 2 68947281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTGCAGACTGAAGGAAAC -3'
(R):5'- ACATATGTGCACGTGTGTGG -3'

Sequencing Primer
(F):5'- CTTCTAGGCTGCCAAAATG -3'
(R):5'- CATCAATTAGTCTAGGCTGGCCG -3'
Posted On2014-12-04