Incidental Mutation 'R2497:Cdkl2'
ID251044
Institutional Source Beutler Lab
Gene Symbol Cdkl2
Ensembl Gene ENSMUSG00000029403
Gene Namecyclin-dependent kinase-like 2 (CDC2-related kinase)
Synonyms5330436L21Rik, KKIAMRE, Kkm
MMRRC Submission 040411-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2497 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92006074-92043883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92008998 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 566 (H566L)
Ref Sequence ENSEMBL: ENSMUSP00000108765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069937] [ENSMUST00000086978] [ENSMUST00000113140] [ENSMUST00000113143]
Predicted Effect probably benign
Transcript: ENSMUST00000069937
SMART Domains Protein: ENSMUSP00000063617
Gene: ENSMUSG00000029403

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086978
AA Change: H566L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084199
Gene: ENSMUSG00000029403
AA Change: H566L

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113140
AA Change: H566L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108765
Gene: ENSMUSG00000029403
AA Change: H566L

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113143
SMART Domains Protein: ENSMUSP00000108768
Gene: ENSMUSG00000029403

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136037
Meta Mutation Damage Score 0.0867 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the cytoplasm, with lower levels in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,267 probably benign Het
Acox2 A G 14: 8,251,612 V295A probably benign Het
Agrn T C 4: 156,173,811 E959G probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arhgap39 C A 15: 76,725,385 V1025L probably damaging Het
Atg4d C T 9: 21,273,386 R459* probably null Het
Atp11b A G 3: 35,855,145 S1163G probably damaging Het
Atp13a5 G T 16: 29,339,071 S173* probably null Het
Atp6v1g2 T A 17: 35,236,786 I8N probably damaging Het
Ccdc77 C T 6: 120,325,472 G430R possibly damaging Het
Cdc34b A G 11: 94,742,381 T136A probably benign Het
Cdkal1 A G 13: 29,474,541 S23P unknown Het
Cers6 T C 2: 69,071,446 probably benign Het
Clspn A G 4: 126,572,347 T557A possibly damaging Het
Cmya5 T C 13: 93,098,005 T192A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah17 T G 11: 118,087,024 probably null Het
Dnah8 C T 17: 30,741,365 Q2239* probably null Het
Dscaml1 T C 9: 45,745,078 V1572A probably benign Het
Elfn2 C G 15: 78,674,264 E28Q probably damaging Het
Enam T A 5: 88,502,694 N687K probably benign Het
Flywch1 G A 17: 23,755,711 R652W probably benign Het
Gm5612 T C 9: 18,427,679 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Mmp3 A G 9: 7,450,131 T288A probably benign Het
Mtmr4 T A 11: 87,600,823 F168L probably damaging Het
Myo1d T A 11: 80,674,821 N393Y probably damaging Het
Nacc2 A T 2: 26,089,568 Y285* probably null Het
Nf1 G T 11: 79,443,884 G844V probably damaging Het
Nox4 T A 7: 87,295,876 Y113* probably null Het
Pcdha3 T C 18: 36,947,503 C433R probably benign Het
Pde6c A G 19: 38,153,694 I358V probably damaging Het
Pdgfrb A T 18: 61,078,628 D819V possibly damaging Het
Phf3 C A 1: 30,830,014 R651L probably damaging Het
Prrx1 A G 1: 163,248,265 V244A possibly damaging Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rab27a T C 9: 73,084,981 L97P probably damaging Het
Rnf20 G A 4: 49,652,676 probably null Het
Sdad1 T C 5: 92,300,099 N259S probably benign Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc1a4 T C 11: 20,332,620 probably benign Het
Smyd2 T A 1: 189,885,337 N300I possibly damaging Het
Snd1 A G 6: 28,888,079 I875V probably benign Het
Ssh1 T C 5: 113,958,858 N174S probably damaging Het
Tanc2 T C 11: 105,673,493 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tpcn1 C T 5: 120,538,998 probably null Het
Unc45b A T 11: 82,936,443 I699F probably damaging Het
Uspl1 C T 5: 149,187,854 P27L probably damaging Het
Wdr66 T C 5: 123,283,369 V98A probably damaging Het
Ylpm1 C G 12: 84,996,761 P91R probably damaging Het
Zdhhc23 G A 16: 43,973,915 T132M probably damaging Het
Zfp148 T C 16: 33,496,385 Y434H probably damaging Het
Zhx2 T C 15: 57,823,155 V640A possibly damaging Het
Other mutations in Cdkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Cdkl2 APN 5 92017377 splice site probably null
IGL02481:Cdkl2 APN 5 92037271 missense probably damaging 1.00
IGL02943:Cdkl2 APN 5 92037244 missense possibly damaging 0.81
IGL03187:Cdkl2 APN 5 92017380 critical splice donor site probably null
IGL03251:Cdkl2 APN 5 92033726 missense probably damaging 1.00
R0422:Cdkl2 UTSW 5 92020312 missense probably benign 0.02
R0616:Cdkl2 UTSW 5 92009004 missense probably benign 0.12
R0764:Cdkl2 UTSW 5 92020277 missense probably benign 0.00
R1023:Cdkl2 UTSW 5 92039286 missense possibly damaging 0.58
R2338:Cdkl2 UTSW 5 92033679 missense possibly damaging 0.92
R3926:Cdkl2 UTSW 5 92033139 missense possibly damaging 0.62
R4444:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4445:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4446:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4647:Cdkl2 UTSW 5 92017213 missense probably damaging 0.99
R4664:Cdkl2 UTSW 5 92037265 missense probably damaging 0.99
R5478:Cdkl2 UTSW 5 92039249 nonsense probably null
R5636:Cdkl2 UTSW 5 92033742 missense probably benign 0.01
R6446:Cdkl2 UTSW 5 92033217 missense probably damaging 1.00
R7051:Cdkl2 UTSW 5 92033225 missense probably damaging 0.99
R7096:Cdkl2 UTSW 5 92033184 nonsense probably null
R7388:Cdkl2 UTSW 5 92019459 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTACAGGGGAAAGACTAATCCT -3'
(R):5'- GGGGCCTCTTACTTCATCCT -3'

Sequencing Primer
(F):5'- TGAAGACAGACATGTTCCCCTGG -3'
(R):5'- TCATCCTTTTTCATGAAAGCAATTC -3'
Posted On2014-12-04