Incidental Mutation 'R2497:Tpcn1'
ID251049
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Nametwo pore channel 1
Synonyms5730403B01Rik
MMRRC Submission 040411-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2497 (G1)
Quality Score159
Status Validated
Chromosome5
Chromosomal Location120534153-120588673 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 120538998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426] [ENSMUST00000068326] [ENSMUST00000076051] [ENSMUST00000111890]
Predicted Effect probably null
Transcript: ENSMUST00000046426
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068326
SMART Domains Protein: ENSMUSP00000064714
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 103 246 5.7e-25 PFAM
low complexity region 262 275 N/A INTRINSIC
low complexity region 337 351 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 421 574 1.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076051
SMART Domains Protein: ENSMUSP00000075428
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 113 244 9.2e-19 PFAM
low complexity region 262 275 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 431 477 2.3e-8 PFAM
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111890
SMART Domains Protein: ENSMUSP00000107521
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 116 227 2.8e-12 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 370 392 N/A INTRINSIC
Pfam:Na_Ca_ex 414 555 3.2e-27 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,267 probably benign Het
Acox2 A G 14: 8,251,612 V295A probably benign Het
Agrn T C 4: 156,173,811 E959G probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arhgap39 C A 15: 76,725,385 V1025L probably damaging Het
Atg4d C T 9: 21,273,386 R459* probably null Het
Atp11b A G 3: 35,855,145 S1163G probably damaging Het
Atp13a5 G T 16: 29,339,071 S173* probably null Het
Atp6v1g2 T A 17: 35,236,786 I8N probably damaging Het
Ccdc77 C T 6: 120,325,472 G430R possibly damaging Het
Cdc34b A G 11: 94,742,381 T136A probably benign Het
Cdkal1 A G 13: 29,474,541 S23P unknown Het
Cdkl2 T A 5: 92,008,998 H566L probably benign Het
Cers6 T C 2: 69,071,446 probably benign Het
Clspn A G 4: 126,572,347 T557A possibly damaging Het
Cmya5 T C 13: 93,098,005 T192A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah17 T G 11: 118,087,024 probably null Het
Dnah8 C T 17: 30,741,365 Q2239* probably null Het
Dscaml1 T C 9: 45,745,078 V1572A probably benign Het
Elfn2 C G 15: 78,674,264 E28Q probably damaging Het
Enam T A 5: 88,502,694 N687K probably benign Het
Flywch1 G A 17: 23,755,711 R652W probably benign Het
Gm5612 T C 9: 18,427,679 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Mmp3 A G 9: 7,450,131 T288A probably benign Het
Mtmr4 T A 11: 87,600,823 F168L probably damaging Het
Myo1d T A 11: 80,674,821 N393Y probably damaging Het
Nacc2 A T 2: 26,089,568 Y285* probably null Het
Nf1 G T 11: 79,443,884 G844V probably damaging Het
Nox4 T A 7: 87,295,876 Y113* probably null Het
Pcdha3 T C 18: 36,947,503 C433R probably benign Het
Pde6c A G 19: 38,153,694 I358V probably damaging Het
Pdgfrb A T 18: 61,078,628 D819V possibly damaging Het
Phf3 C A 1: 30,830,014 R651L probably damaging Het
Prrx1 A G 1: 163,248,265 V244A possibly damaging Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rab27a T C 9: 73,084,981 L97P probably damaging Het
Rnf20 G A 4: 49,652,676 probably null Het
Sdad1 T C 5: 92,300,099 N259S probably benign Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc1a4 T C 11: 20,332,620 probably benign Het
Smyd2 T A 1: 189,885,337 N300I possibly damaging Het
Snd1 A G 6: 28,888,079 I875V probably benign Het
Ssh1 T C 5: 113,958,858 N174S probably damaging Het
Tanc2 T C 11: 105,673,493 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Unc45b A T 11: 82,936,443 I699F probably damaging Het
Uspl1 C T 5: 149,187,854 P27L probably damaging Het
Wdr66 T C 5: 123,283,369 V98A probably damaging Het
Ylpm1 C G 12: 84,996,761 P91R probably damaging Het
Zdhhc23 G A 16: 43,973,915 T132M probably damaging Het
Zfp148 T C 16: 33,496,385 Y434H probably damaging Het
Zhx2 T C 15: 57,823,155 V640A possibly damaging Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1577:Tpcn1 UTSW 5 120544420 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R3965:Tpcn1 UTSW 5 120556575 missense probably damaging 0.98
R3972:Tpcn1 UTSW 5 120553752 critical splice donor site probably null
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4343:Tpcn1 UTSW 5 120560220 missense probably damaging 1.00
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4831:Tpcn1 UTSW 5 120553489 missense probably damaging 1.00
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5910:Tpcn1 UTSW 5 120547397 intron probably benign
R5939:Tpcn1 UTSW 5 120539827 missense probably damaging 1.00
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7629:Tpcn1 UTSW 5 120537937 missense probably benign 0.00
R7854:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
R7937:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATGGCAGCTACTTGTTATAC -3'
(R):5'- ACATAGTGACCATGGTAGGTGTC -3'

Sequencing Primer
(F):5'- TATACATTTAGGAACCGTGGGC -3'
(R):5'- ATGGTAGGTGTCGCCACAG -3'
Posted On2014-12-04