Incidental Mutation 'R2696:Zfp27'
ID251061
Institutional Source Beutler Lab
Gene Symbol Zfp27
Ensembl Gene ENSMUSG00000062040
Gene Namezinc finger protein 27
Synonymsmkr-4, Zfp-27
MMRRC Submission 040434-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R2696 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29893333-29906572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29896367 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 58 (A58T)
Ref Sequence ENSEMBL: ENSMUSP00000127677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053521] [ENSMUST00000159920] [ENSMUST00000161904] [ENSMUST00000162592] [ENSMUST00000172448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053521
AA Change: A58T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054012
Gene: ENSMUSG00000062040
AA Change: A58T

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159920
AA Change: A58T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125232
Gene: ENSMUSG00000062040
AA Change: A58T

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160411
Predicted Effect possibly damaging
Transcript: ENSMUST00000161904
AA Change: A58T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124684
Gene: ENSMUSG00000062040
AA Change: A58T

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162592
AA Change: A58T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123953
Gene: ENSMUSG00000062040
AA Change: A58T

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172448
AA Change: A58T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127677
Gene: ENSMUSG00000062040
AA Change: A58T

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,850,364 T540S probably benign Het
Acp7 G T 7: 28,614,576 H369Q probably benign Het
Adgrg3 A G 8: 95,021,074 N65S probably benign Het
Anln A G 9: 22,360,963 V620A probably benign Het
Atp10a T A 7: 58,813,618 S966R probably benign Het
Atp8b3 T A 10: 80,534,183 Q132L possibly damaging Het
Col4a1 T A 8: 11,235,092 probably null Het
Ddx21 T C 10: 62,594,092 H291R possibly damaging Het
Dlgap3 A G 4: 127,194,623 Y4C probably damaging Het
Dnah5 A G 15: 28,278,576 N1106D probably benign Het
Esyt1 T C 10: 128,517,045 D662G probably damaging Het
F830016B08Rik T A 18: 60,300,736 V297E possibly damaging Het
Faf1 T A 4: 109,841,328 N328K possibly damaging Het
Gdf3 A C 6: 122,606,900 F169L probably benign Het
Ifi213 G A 1: 173,590,024 T274I probably benign Het
Igf2r T C 17: 12,695,344 D1746G possibly damaging Het
Ighv1-75 T C 12: 115,834,206 K32R probably benign Het
Ipo8 T A 6: 148,796,741 Q594L probably benign Het
Krt83 A T 15: 101,487,009 I402N probably benign Het
Med18 G A 4: 132,459,970 R118W probably damaging Het
Mmrn2 A G 14: 34,398,415 E414G probably damaging Het
Myo6 A G 9: 80,260,894 T447A probably benign Het
Ncoa6 T C 2: 155,438,015 E27G probably benign Het
Ngly1 T C 14: 16,283,439 L406S possibly damaging Het
Olfr125 T C 17: 37,835,107 I36T probably benign Het
Olfr630 A G 7: 103,755,528 I19T probably damaging Het
Phldb1 T C 9: 44,718,288 Y156C probably damaging Het
Pkd2l1 T A 19: 44,157,269 T172S probably benign Het
Pknox2 G A 9: 36,909,691 R292* probably null Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Polr3e T C 7: 120,933,377 L212P probably damaging Het
Ppp4r4 A G 12: 103,581,394 I215M possibly damaging Het
Psmg2 T C 18: 67,648,218 Y127H possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptp4a1 A T 1: 30,946,132 M4K probably benign Het
R3hcc1l A T 19: 42,563,988 I475L possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rsf1 GGC GGCGGCGGCGGC 7: 97,579,933 probably benign Het
Sec63 T A 10: 42,783,526 I70N probably benign Het
Slc2a5 A C 4: 150,120,746 K4T probably benign Het
Slc4a3 A G 1: 75,555,475 Y939C possibly damaging Het
Slc7a15 T C 12: 8,529,345 *229W probably null Het
Slco1a6 C A 6: 142,112,936 G206C probably damaging Het
Spata9 A G 13: 75,977,776 Q126R probably benign Het
Speg A T 1: 75,406,926 D1186V probably benign Het
Spink5 T G 18: 43,982,292 M197R probably damaging Het
Stab2 T C 10: 86,861,499 D1975G probably benign Het
Syngap1 T A 17: 26,957,411 C224* probably null Het
Ttn T C 2: 76,868,463 probably benign Het
Txnrd1 G A 10: 82,885,282 E397K probably benign Het
Ugt2b36 A T 5: 87,089,485 M313K probably damaging Het
Ulk3 A G 9: 57,590,441 I74V possibly damaging Het
Zcchc4 T C 5: 52,796,231 V194A probably damaging Het
Zfp398 T G 6: 47,866,945 *512E probably null Het
Other mutations in Zfp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Zfp27 APN 7 29894958 missense probably damaging 0.97
IGL02490:Zfp27 APN 7 29894935 missense possibly damaging 0.73
IGL02899:Zfp27 APN 7 29896255 missense possibly damaging 0.91
R0179:Zfp27 UTSW 7 29896425 missense possibly damaging 0.51
R0234:Zfp27 UTSW 7 29894107 missense possibly damaging 0.73
R0234:Zfp27 UTSW 7 29894107 missense possibly damaging 0.73
R0511:Zfp27 UTSW 7 29894522 missense probably damaging 0.97
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1294:Zfp27 UTSW 7 29896312 missense possibly damaging 0.53
R1581:Zfp27 UTSW 7 29896124 missense possibly damaging 0.53
R1763:Zfp27 UTSW 7 29895376 missense possibly damaging 0.96
R2083:Zfp27 UTSW 7 29894783 missense probably benign 0.06
R2217:Zfp27 UTSW 7 29896111 missense possibly damaging 0.96
R4084:Zfp27 UTSW 7 29895367 missense possibly damaging 0.91
R4864:Zfp27 UTSW 7 29894836 missense probably damaging 0.99
R6057:Zfp27 UTSW 7 29895019 missense possibly damaging 0.83
R6063:Zfp27 UTSW 7 29894302 missense probably damaging 0.97
R6553:Zfp27 UTSW 7 29896393 missense possibly damaging 0.86
R6585:Zfp27 UTSW 7 29896393 missense possibly damaging 0.86
R6800:Zfp27 UTSW 7 29894435 missense probably benign 0.19
R7051:Zfp27 UTSW 7 29895021 small deletion probably benign
R7052:Zfp27 UTSW 7 29895021 small deletion probably benign
R7066:Zfp27 UTSW 7 29895021 small deletion probably benign
R7106:Zfp27 UTSW 7 29895021 small deletion probably benign
R7432:Zfp27 UTSW 7 29895359 missense probably benign 0.33
R7473:Zfp27 UTSW 7 29895899 missense possibly damaging 0.71
R7670:Zfp27 UTSW 7 29894796 missense possibly damaging 0.94
R7739:Zfp27 UTSW 7 29894274 missense possibly damaging 0.93
R7817:Zfp27 UTSW 7 29896390 missense possibly damaging 0.96
Z1177:Zfp27 UTSW 7 29895161 missense probably benign 0.33
Z1177:Zfp27 UTSW 7 29896232 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCCCATTACTTTCATCATGAGTCTG -3'
(R):5'- ACAGACACCTTGCTGTGCTG -3'

Sequencing Primer
(F):5'- GTAAATCTGAACTATGCTTCGGCTC -3'
(R):5'- AGGAACTTGGCTTTAGAGCTG -3'
Posted On2014-12-04