Incidental Mutation 'R2696:Olfr630'
ID251065
Institutional Source Beutler Lab
Gene Symbol Olfr630
Ensembl Gene ENSMUSG00000050281
Gene Nameolfactory receptor 630
SynonymsMOR17-1, GA_x6K02T2PBJ9-6483085-6482126
MMRRC Submission 040434-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R2696 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103753480-103757333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103755528 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 19 (I19T)
Ref Sequence ENSEMBL: ENSMUSP00000102493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106880]
Predicted Effect probably damaging
Transcript: ENSMUST00000052826
AA Change: I19T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049569
Gene: ENSMUSG00000050281
AA Change: I19T

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.4e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 305 3.7e-8 PFAM
Pfam:7tm_1 43 294 1.1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106880
AA Change: I19T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102493
Gene: ENSMUSG00000050281
AA Change: I19T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 305 3.7e-8 PFAM
Pfam:7tm_1 43 294 8.4e-25 PFAM
Pfam:7tm_4 144 287 9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217072
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,850,364 T540S probably benign Het
Acp7 G T 7: 28,614,576 H369Q probably benign Het
Adgrg3 A G 8: 95,021,074 N65S probably benign Het
Anln A G 9: 22,360,963 V620A probably benign Het
Atp10a T A 7: 58,813,618 S966R probably benign Het
Atp8b3 T A 10: 80,534,183 Q132L possibly damaging Het
Col4a1 T A 8: 11,235,092 probably null Het
Ddx21 T C 10: 62,594,092 H291R possibly damaging Het
Dlgap3 A G 4: 127,194,623 Y4C probably damaging Het
Dnah5 A G 15: 28,278,576 N1106D probably benign Het
Esyt1 T C 10: 128,517,045 D662G probably damaging Het
F830016B08Rik T A 18: 60,300,736 V297E possibly damaging Het
Faf1 T A 4: 109,841,328 N328K possibly damaging Het
Gdf3 A C 6: 122,606,900 F169L probably benign Het
Ifi213 G A 1: 173,590,024 T274I probably benign Het
Igf2r T C 17: 12,695,344 D1746G possibly damaging Het
Ighv1-75 T C 12: 115,834,206 K32R probably benign Het
Ipo8 T A 6: 148,796,741 Q594L probably benign Het
Krt83 A T 15: 101,487,009 I402N probably benign Het
Med18 G A 4: 132,459,970 R118W probably damaging Het
Mmrn2 A G 14: 34,398,415 E414G probably damaging Het
Myo6 A G 9: 80,260,894 T447A probably benign Het
Ncoa6 T C 2: 155,438,015 E27G probably benign Het
Ngly1 T C 14: 16,283,439 L406S possibly damaging Het
Olfr125 T C 17: 37,835,107 I36T probably benign Het
Phldb1 T C 9: 44,718,288 Y156C probably damaging Het
Pkd2l1 T A 19: 44,157,269 T172S probably benign Het
Pknox2 G A 9: 36,909,691 R292* probably null Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Polr3e T C 7: 120,933,377 L212P probably damaging Het
Ppp4r4 A G 12: 103,581,394 I215M possibly damaging Het
Psmg2 T C 18: 67,648,218 Y127H possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptp4a1 A T 1: 30,946,132 M4K probably benign Het
R3hcc1l A T 19: 42,563,988 I475L possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rsf1 GGC GGCGGCGGCGGC 7: 97,579,933 probably benign Het
Sec63 T A 10: 42,783,526 I70N probably benign Het
Slc2a5 A C 4: 150,120,746 K4T probably benign Het
Slc4a3 A G 1: 75,555,475 Y939C possibly damaging Het
Slc7a15 T C 12: 8,529,345 *229W probably null Het
Slco1a6 C A 6: 142,112,936 G206C probably damaging Het
Spata9 A G 13: 75,977,776 Q126R probably benign Het
Speg A T 1: 75,406,926 D1186V probably benign Het
Spink5 T G 18: 43,982,292 M197R probably damaging Het
Stab2 T C 10: 86,861,499 D1975G probably benign Het
Syngap1 T A 17: 26,957,411 C224* probably null Het
Ttn T C 2: 76,868,463 probably benign Het
Txnrd1 G A 10: 82,885,282 E397K probably benign Het
Ugt2b36 A T 5: 87,089,485 M313K probably damaging Het
Ulk3 A G 9: 57,590,441 I74V possibly damaging Het
Zcchc4 T C 5: 52,796,231 V194A probably damaging Het
Zfp27 C T 7: 29,896,367 A58T possibly damaging Het
Zfp398 T G 6: 47,866,945 *512E probably null Het
Other mutations in Olfr630
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Olfr630 APN 7 103755006 missense probably damaging 1.00
IGL01111:Olfr630 APN 7 103755373 missense probably benign 0.07
IGL02456:Olfr630 APN 7 103755493 missense possibly damaging 0.94
IGL03173:Olfr630 APN 7 103754976 missense probably benign 0.00
R1104:Olfr630 UTSW 7 103754976 missense probably benign 0.00
R1507:Olfr630 UTSW 7 103755021 missense probably benign 0.00
R1695:Olfr630 UTSW 7 103754924 nonsense probably null
R1966:Olfr630 UTSW 7 103755168 missense probably damaging 1.00
R1971:Olfr630 UTSW 7 103755320 nonsense probably null
R4943:Olfr630 UTSW 7 103755296 missense probably benign 0.12
R5622:Olfr630 UTSW 7 103755169 missense probably damaging 0.99
R6365:Olfr630 UTSW 7 103755195 missense probably benign 0.00
R7592:Olfr630 UTSW 7 103755072 missense probably damaging 1.00
R8146:Olfr630 UTSW 7 103755303 missense probably damaging 1.00
R8283:Olfr630 UTSW 7 103754812 missense possibly damaging 0.51
R8867:Olfr630 UTSW 7 103754686 nonsense probably null
R8875:Olfr630 UTSW 7 103755255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCATGTCAGTGAGTG -3'
(R):5'- CCTTGATGGCAGTAAAGGGC -3'

Sequencing Primer
(F):5'- CATGTCAGTGAGTGAAAGCATAGCC -3'
(R):5'- GGCTTTTAAAAATTATTGCTGCCC -3'
Posted On2014-12-04