Incidental Mutation 'R2696:Ulk3'
ID251075
Institutional Source Beutler Lab
Gene Symbol Ulk3
Ensembl Gene ENSMUSG00000032308
Gene Nameunc-51-like kinase 3
Synonyms
MMRRC Submission 040434-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2696 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57589452-57596233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57590441 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 74 (I74V)
Ref Sequence ENSEMBL: ENSMUSP00000059947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045791] [ENSMUST00000053230] [ENSMUST00000215748]
Predicted Effect probably benign
Transcript: ENSMUST00000045791
SMART Domains Protein: ENSMUSP00000038350
Gene: ENSMUSG00000040188

DomainStartEndE-ValueType
low complexity region 69 83 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
Pfam:SCAMP 117 293 2.6e-68 PFAM
low complexity region 309 328 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000053230
AA Change: I74V

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059947
Gene: ENSMUSG00000032308
AA Change: I74V

DomainStartEndE-ValueType
S_TKc 14 270 4.74e-98 SMART
MIT 277 354 1.1e-10 SMART
MIT 372 450 2.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215146
Predicted Effect probably benign
Transcript: ENSMUST00000215748
AA Change: I33V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217200
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,850,364 T540S probably benign Het
Acp7 G T 7: 28,614,576 H369Q probably benign Het
Adgrg3 A G 8: 95,021,074 N65S probably benign Het
Anln A G 9: 22,360,963 V620A probably benign Het
Atp10a T A 7: 58,813,618 S966R probably benign Het
Atp8b3 T A 10: 80,534,183 Q132L possibly damaging Het
Col4a1 T A 8: 11,235,092 probably null Het
Ddx21 T C 10: 62,594,092 H291R possibly damaging Het
Dlgap3 A G 4: 127,194,623 Y4C probably damaging Het
Dnah5 A G 15: 28,278,576 N1106D probably benign Het
Esyt1 T C 10: 128,517,045 D662G probably damaging Het
F830016B08Rik T A 18: 60,300,736 V297E possibly damaging Het
Faf1 T A 4: 109,841,328 N328K possibly damaging Het
Gdf3 A C 6: 122,606,900 F169L probably benign Het
Ifi213 G A 1: 173,590,024 T274I probably benign Het
Igf2r T C 17: 12,695,344 D1746G possibly damaging Het
Ighv1-75 T C 12: 115,834,206 K32R probably benign Het
Ipo8 T A 6: 148,796,741 Q594L probably benign Het
Krt83 A T 15: 101,487,009 I402N probably benign Het
Med18 G A 4: 132,459,970 R118W probably damaging Het
Mmrn2 A G 14: 34,398,415 E414G probably damaging Het
Myo6 A G 9: 80,260,894 T447A probably benign Het
Ncoa6 T C 2: 155,438,015 E27G probably benign Het
Ngly1 T C 14: 16,283,439 L406S possibly damaging Het
Olfr125 T C 17: 37,835,107 I36T probably benign Het
Olfr630 A G 7: 103,755,528 I19T probably damaging Het
Phldb1 T C 9: 44,718,288 Y156C probably damaging Het
Pkd2l1 T A 19: 44,157,269 T172S probably benign Het
Pknox2 G A 9: 36,909,691 R292* probably null Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Polr3e T C 7: 120,933,377 L212P probably damaging Het
Ppp4r4 A G 12: 103,581,394 I215M possibly damaging Het
Psmg2 T C 18: 67,648,218 Y127H possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptp4a1 A T 1: 30,946,132 M4K probably benign Het
R3hcc1l A T 19: 42,563,988 I475L possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rsf1 GGC GGCGGCGGCGGC 7: 97,579,933 probably benign Het
Sec63 T A 10: 42,783,526 I70N probably benign Het
Slc2a5 A C 4: 150,120,746 K4T probably benign Het
Slc4a3 A G 1: 75,555,475 Y939C possibly damaging Het
Slc7a15 T C 12: 8,529,345 *229W probably null Het
Slco1a6 C A 6: 142,112,936 G206C probably damaging Het
Spata9 A G 13: 75,977,776 Q126R probably benign Het
Speg A T 1: 75,406,926 D1186V probably benign Het
Spink5 T G 18: 43,982,292 M197R probably damaging Het
Stab2 T C 10: 86,861,499 D1975G probably benign Het
Syngap1 T A 17: 26,957,411 C224* probably null Het
Ttn T C 2: 76,868,463 probably benign Het
Txnrd1 G A 10: 82,885,282 E397K probably benign Het
Ugt2b36 A T 5: 87,089,485 M313K probably damaging Het
Zcchc4 T C 5: 52,796,231 V194A probably damaging Het
Zfp27 C T 7: 29,896,367 A58T possibly damaging Het
Zfp398 T G 6: 47,866,945 *512E probably null Het
Other mutations in Ulk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Ulk3 UTSW 9 57590356 nonsense probably null
R0164:Ulk3 UTSW 9 57590686 missense probably damaging 1.00
R0164:Ulk3 UTSW 9 57590686 missense probably damaging 1.00
R0334:Ulk3 UTSW 9 57594227 unclassified probably benign
R0391:Ulk3 UTSW 9 57594832 missense probably benign
R1635:Ulk3 UTSW 9 57593160 critical splice acceptor site probably null
R3689:Ulk3 UTSW 9 57593794 missense probably benign 0.44
R4151:Ulk3 UTSW 9 57592367 missense possibly damaging 0.64
R4502:Ulk3 UTSW 9 57593229 missense probably damaging 1.00
R4586:Ulk3 UTSW 9 57594310 missense possibly damaging 0.81
R4746:Ulk3 UTSW 9 57592918 missense probably benign
R5034:Ulk3 UTSW 9 57593764 missense possibly damaging 0.88
R5288:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R5385:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R5386:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R7480:Ulk3 UTSW 9 57591240 nonsense probably null
R7581:Ulk3 UTSW 9 57592042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTGCAGACTCAGAGCC -3'
(R):5'- CCACTGTGGTTGCAAGTAAAG -3'

Sequencing Primer
(F):5'- TTTGCAGACTCAGAGCCCACTC -3'
(R):5'- TGAGTTCCAGGACAGCCAG -3'
Posted On2014-12-04