Incidental Mutation 'R2696:Atp8b3'
ID 251085
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission 040434-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R2696 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80370017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 132 (Q132L)
Ref Sequence ENSEMBL: ENSMUSP00000151571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000219648] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: Q132L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: Q132L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219648
Predicted Effect possibly damaging
Transcript: ENSMUST00000220326
AA Change: Q132L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,668,228 (GRCm39) T540S probably benign Het
Acp7 G T 7: 28,314,001 (GRCm39) H369Q probably benign Het
Adgrg3 A G 8: 95,747,702 (GRCm39) N65S probably benign Het
Anln A G 9: 22,272,259 (GRCm39) V620A probably benign Het
Atp10a T A 7: 58,463,366 (GRCm39) S966R probably benign Het
Col4a1 T A 8: 11,285,092 (GRCm39) probably null Het
Ddx21 T C 10: 62,429,871 (GRCm39) H291R possibly damaging Het
Dlgap3 A G 4: 127,088,416 (GRCm39) Y4C probably damaging Het
Dnah5 A G 15: 28,278,722 (GRCm39) N1106D probably benign Het
Esyt1 T C 10: 128,352,914 (GRCm39) D662G probably damaging Het
F830016B08Rik T A 18: 60,433,808 (GRCm39) V297E possibly damaging Het
Faf1 T A 4: 109,698,525 (GRCm39) N328K possibly damaging Het
Gdf3 A C 6: 122,583,859 (GRCm39) F169L probably benign Het
Ifi213 G A 1: 173,417,590 (GRCm39) T274I probably benign Het
Igf2r T C 17: 12,914,231 (GRCm39) D1746G possibly damaging Het
Ighv1-75 T C 12: 115,797,826 (GRCm39) K32R probably benign Het
Ipo8 T A 6: 148,698,239 (GRCm39) Q594L probably benign Het
Krt87 A T 15: 101,384,890 (GRCm39) I402N probably benign Het
Med18 G A 4: 132,187,281 (GRCm39) R118W probably damaging Het
Mmrn2 A G 14: 34,120,372 (GRCm39) E414G probably damaging Het
Myo6 A G 9: 80,168,176 (GRCm39) T447A probably benign Het
Ncoa6 T C 2: 155,279,935 (GRCm39) E27G probably benign Het
Ngly1 T C 14: 16,283,439 (GRCm38) L406S possibly damaging Het
Or14j1 T C 17: 38,145,998 (GRCm39) I36T probably benign Het
Or51l4 A G 7: 103,404,735 (GRCm39) I19T probably damaging Het
Phldb1 T C 9: 44,629,585 (GRCm39) Y156C probably damaging Het
Pkd2l1 T A 19: 44,145,708 (GRCm39) T172S probably benign Het
Pknox2 G A 9: 36,820,987 (GRCm39) R292* probably null Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Polr3e T C 7: 120,532,600 (GRCm39) L212P probably damaging Het
Ppp4r4 A G 12: 103,547,653 (GRCm39) I215M possibly damaging Het
Psmg2 T C 18: 67,781,288 (GRCm39) Y127H possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptp4a1 A T 1: 30,985,213 (GRCm39) M4K probably benign Het
R3hcc1l A T 19: 42,552,427 (GRCm39) I475L possibly damaging Het
Rbp3 C T 14: 33,677,975 (GRCm39) T641M probably damaging Het
Rsf1 GGC GGCGGCGGCGGC 7: 97,229,140 (GRCm39) probably benign Het
Sec63 T A 10: 42,659,522 (GRCm39) I70N probably benign Het
Slc2a5 A C 4: 150,205,203 (GRCm39) K4T probably benign Het
Slc4a3 A G 1: 75,532,119 (GRCm39) Y939C possibly damaging Het
Slc7a15 T C 12: 8,579,345 (GRCm39) *229W probably null Het
Slco1a6 C A 6: 142,058,662 (GRCm39) G206C probably damaging Het
Spata9 A G 13: 76,125,895 (GRCm39) Q126R probably benign Het
Speg A T 1: 75,383,570 (GRCm39) D1186V probably benign Het
Spink5 T G 18: 44,115,359 (GRCm39) M197R probably damaging Het
Stab2 T C 10: 86,697,363 (GRCm39) D1975G probably benign Het
Syngap1 T A 17: 27,176,385 (GRCm39) C224* probably null Het
Ttn T C 2: 76,698,807 (GRCm39) probably benign Het
Txnrd1 G A 10: 82,721,116 (GRCm39) E397K probably benign Het
Ugt2b36 A T 5: 87,237,344 (GRCm39) M313K probably damaging Het
Ulk3 A G 9: 57,497,724 (GRCm39) I74V possibly damaging Het
Zcchc4 T C 5: 52,953,573 (GRCm39) V194A probably damaging Het
Zfp27 C T 7: 29,595,792 (GRCm39) A58T possibly damaging Het
Zfp398 T G 6: 47,843,879 (GRCm39) *512E probably null Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGACTCAGCTGGGATGTAC -3'
(R):5'- CACTCGTGATCTTGTGGATGAC -3'

Sequencing Primer
(F):5'- CTCAACTGAGAGGTCGACTC -3'
(R):5'- TGTCCACACAGGGAGCAG -3'
Posted On 2014-12-04