Mutagenetix > Incidental Mutation

Incidental Mutation 'R2696:Atp8b3'

251085

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

040434-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R2696 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80534183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 132 (Q132L)

Ref Sequence

ENSEMBL: ENSMUSP00000151571 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000219648] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: Q132L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: Q132L

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219648

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220326
AA Change: Q132L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	A	T	16: 4,850,364	T540S	probably benign	Het
Acp7	G	T	7: 28,614,576	H369Q	probably benign	Het
Adgrg3	A	G	8: 95,021,074	N65S	probably benign	Het
Anln	A	G	9: 22,360,963	V620A	probably benign	Het
Atp10a	T	A	7: 58,813,618	S966R	probably benign	Het
Col4a1	T	A	8: 11,235,092		probably null	Het
Ddx21	T	C	10: 62,594,092	H291R	possibly damaging	Het
Dlgap3	A	G	4: 127,194,623	Y4C	probably damaging	Het
Dnah5	A	G	15: 28,278,576	N1106D	probably benign	Het
Esyt1	T	C	10: 128,517,045	D662G	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,736	V297E	possibly damaging	Het
Faf1	T	A	4: 109,841,328	N328K	possibly damaging	Het
Gdf3	A	C	6: 122,606,900	F169L	probably benign	Het
Ifi213	G	A	1: 173,590,024	T274I	probably benign	Het
Igf2r	T	C	17: 12,695,344	D1746G	possibly damaging	Het
Ighv1-75	T	C	12: 115,834,206	K32R	probably benign	Het
Ipo8	T	A	6: 148,796,741	Q594L	probably benign	Het
Krt83	A	T	15: 101,487,009	I402N	probably benign	Het
Med18	G	A	4: 132,459,970	R118W	probably damaging	Het
Mmrn2	A	G	14: 34,398,415	E414G	probably damaging	Het
Myo6	A	G	9: 80,260,894	T447A	probably benign	Het
Ncoa6	T	C	2: 155,438,015	E27G	probably benign	Het
Ngly1	T	C	14: 16,283,439	L406S	possibly damaging	Het
Olfr125	T	C	17: 37,835,107	I36T	probably benign	Het
Olfr630	A	G	7: 103,755,528	I19T	probably damaging	Het
Phldb1	T	C	9: 44,718,288	Y156C	probably damaging	Het
Pkd2l1	T	A	19: 44,157,269	T172S	probably benign	Het
Pknox2	G	A	9: 36,909,691	R292*	probably null	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Polr3e	T	C	7: 120,933,377	L212P	probably damaging	Het
Ppp4r4	A	G	12: 103,581,394	I215M	possibly damaging	Het
Psmg2	T	C	18: 67,648,218	Y127H	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptp4a1	A	T	1: 30,946,132	M4K	probably benign	Het
R3hcc1l	A	T	19: 42,563,988	I475L	possibly damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rsf1	GGC	GGCGGCGGCGGC	7: 97,579,933		probably benign	Het
Sec63	T	A	10: 42,783,526	I70N	probably benign	Het
Slc2a5	A	C	4: 150,120,746	K4T	probably benign	Het
Slc4a3	A	G	1: 75,555,475	Y939C	possibly damaging	Het
Slc7a15	T	C	12: 8,529,345	*229W	probably null	Het
Slco1a6	C	A	6: 142,112,936	G206C	probably damaging	Het
Spata9	A	G	13: 75,977,776	Q126R	probably benign	Het
Speg	A	T	1: 75,406,926	D1186V	probably benign	Het
Spink5	T	G	18: 43,982,292	M197R	probably damaging	Het
Stab2	T	C	10: 86,861,499	D1975G	probably benign	Het
Syngap1	T	A	17: 26,957,411	C224*	probably null	Het
Ttn	T	C	2: 76,868,463		probably benign	Het
Txnrd1	G	A	10: 82,885,282	E397K	probably benign	Het
Ugt2b36	A	T	5: 87,089,485	M313K	probably damaging	Het
Ulk3	A	G	9: 57,590,441	I74V	possibly damaging	Het
Zcchc4	T	C	5: 52,796,231	V194A	probably damaging	Het
Zfp27	C	T	7: 29,896,367	A58T	possibly damaging	Het
Zfp398	T	G	6: 47,866,945	*512E	probably null	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CAGACTCAGCTGGGATGTAC -3'
(R):5'- CACTCGTGATCTTGTGGATGAC -3'

Sequencing Primer
(F):5'- CTCAACTGAGAGGTCGACTC -3'
(R):5'- TGTCCACACAGGGAGCAG -3'

Posted On

2014-12-04