Incidental Mutation 'R2497:Myo1d'
ID251087
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
MMRRC Submission 040411-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2497 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80674821 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 393 (N393Y)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect probably damaging
Transcript: ENSMUST00000041065
AA Change: N393Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: N393Y

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070997
AA Change: N393Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: N393Y

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125944
Meta Mutation Damage Score 0.9740 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,267 probably benign Het
Acox2 A G 14: 8,251,612 V295A probably benign Het
Agrn T C 4: 156,173,811 E959G probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arhgap39 C A 15: 76,725,385 V1025L probably damaging Het
Atg4d C T 9: 21,273,386 R459* probably null Het
Atp11b A G 3: 35,855,145 S1163G probably damaging Het
Atp13a5 G T 16: 29,339,071 S173* probably null Het
Atp6v1g2 T A 17: 35,236,786 I8N probably damaging Het
Ccdc77 C T 6: 120,325,472 G430R possibly damaging Het
Cdc34b A G 11: 94,742,381 T136A probably benign Het
Cdkal1 A G 13: 29,474,541 S23P unknown Het
Cdkl2 T A 5: 92,008,998 H566L probably benign Het
Cers6 T C 2: 69,071,446 probably benign Het
Clspn A G 4: 126,572,347 T557A possibly damaging Het
Cmya5 T C 13: 93,098,005 T192A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah17 T G 11: 118,087,024 probably null Het
Dnah8 C T 17: 30,741,365 Q2239* probably null Het
Dscaml1 T C 9: 45,745,078 V1572A probably benign Het
Elfn2 C G 15: 78,674,264 E28Q probably damaging Het
Enam T A 5: 88,502,694 N687K probably benign Het
Flywch1 G A 17: 23,755,711 R652W probably benign Het
Gm5612 T C 9: 18,427,679 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Mmp3 A G 9: 7,450,131 T288A probably benign Het
Mtmr4 T A 11: 87,600,823 F168L probably damaging Het
Nacc2 A T 2: 26,089,568 Y285* probably null Het
Nf1 G T 11: 79,443,884 G844V probably damaging Het
Nox4 T A 7: 87,295,876 Y113* probably null Het
Pcdha3 T C 18: 36,947,503 C433R probably benign Het
Pde6c A G 19: 38,153,694 I358V probably damaging Het
Pdgfrb A T 18: 61,078,628 D819V possibly damaging Het
Phf3 C A 1: 30,830,014 R651L probably damaging Het
Prrx1 A G 1: 163,248,265 V244A possibly damaging Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rab27a T C 9: 73,084,981 L97P probably damaging Het
Rnf20 G A 4: 49,652,676 probably null Het
Sdad1 T C 5: 92,300,099 N259S probably benign Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc1a4 T C 11: 20,332,620 probably benign Het
Smyd2 T A 1: 189,885,337 N300I possibly damaging Het
Snd1 A G 6: 28,888,079 I875V probably benign Het
Ssh1 T C 5: 113,958,858 N174S probably damaging Het
Tanc2 T C 11: 105,673,493 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tpcn1 C T 5: 120,538,998 probably null Het
Unc45b A T 11: 82,936,443 I699F probably damaging Het
Uspl1 C T 5: 149,187,854 P27L probably damaging Het
Wdr66 T C 5: 123,283,369 V98A probably damaging Het
Ylpm1 C G 12: 84,996,761 P91R probably damaging Het
Zdhhc23 G A 16: 43,973,915 T132M probably damaging Het
Zfp148 T C 16: 33,496,385 Y434H probably damaging Het
Zhx2 T C 15: 57,823,155 V640A possibly damaging Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
R8474:Myo1d UTSW 11 80670919 missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80684379 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80674932 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80676932 missense probably benign 0.30
R8823:Myo1d UTSW 11 80601745 missense possibly damaging 0.91
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACTCACGTGTTTCCAAGG -3'
(R):5'- TCGTTCCCAAACAGGCAAGG -3'

Sequencing Primer
(F):5'- CTCACGTGTTTCCAAGGGATGC -3'
(R):5'- GTTCCCAAACAGGCAAGGATTTATG -3'
Posted On2014-12-04