Incidental Mutation 'R2696:Rbp3'
ID251103
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 040434-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R2696 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33956018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 641 (T641M)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably damaging
Transcript: ENSMUST00000035695
AA Change: T641M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: T641M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,850,364 T540S probably benign Het
Acp7 G T 7: 28,614,576 H369Q probably benign Het
Adgrg3 A G 8: 95,021,074 N65S probably benign Het
Anln A G 9: 22,360,963 V620A probably benign Het
Atp10a T A 7: 58,813,618 S966R probably benign Het
Atp8b3 T A 10: 80,534,183 Q132L possibly damaging Het
Col4a1 T A 8: 11,235,092 probably null Het
Ddx21 T C 10: 62,594,092 H291R possibly damaging Het
Dlgap3 A G 4: 127,194,623 Y4C probably damaging Het
Dnah5 A G 15: 28,278,576 N1106D probably benign Het
Esyt1 T C 10: 128,517,045 D662G probably damaging Het
F830016B08Rik T A 18: 60,300,736 V297E possibly damaging Het
Faf1 T A 4: 109,841,328 N328K possibly damaging Het
Gdf3 A C 6: 122,606,900 F169L probably benign Het
Ifi213 G A 1: 173,590,024 T274I probably benign Het
Igf2r T C 17: 12,695,344 D1746G possibly damaging Het
Ighv1-75 T C 12: 115,834,206 K32R probably benign Het
Ipo8 T A 6: 148,796,741 Q594L probably benign Het
Krt83 A T 15: 101,487,009 I402N probably benign Het
Med18 G A 4: 132,459,970 R118W probably damaging Het
Mmrn2 A G 14: 34,398,415 E414G probably damaging Het
Myo6 A G 9: 80,260,894 T447A probably benign Het
Ncoa6 T C 2: 155,438,015 E27G probably benign Het
Ngly1 T C 14: 16,283,439 L406S possibly damaging Het
Olfr125 T C 17: 37,835,107 I36T probably benign Het
Olfr630 A G 7: 103,755,528 I19T probably damaging Het
Phldb1 T C 9: 44,718,288 Y156C probably damaging Het
Pkd2l1 T A 19: 44,157,269 T172S probably benign Het
Pknox2 G A 9: 36,909,691 R292* probably null Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Polr3e T C 7: 120,933,377 L212P probably damaging Het
Ppp4r4 A G 12: 103,581,394 I215M possibly damaging Het
Psmg2 T C 18: 67,648,218 Y127H possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptp4a1 A T 1: 30,946,132 M4K probably benign Het
R3hcc1l A T 19: 42,563,988 I475L possibly damaging Het
Rsf1 GGC GGCGGCGGCGGC 7: 97,579,933 probably benign Het
Sec63 T A 10: 42,783,526 I70N probably benign Het
Slc2a5 A C 4: 150,120,746 K4T probably benign Het
Slc4a3 A G 1: 75,555,475 Y939C possibly damaging Het
Slc7a15 T C 12: 8,529,345 *229W probably null Het
Slco1a6 C A 6: 142,112,936 G206C probably damaging Het
Spata9 A G 13: 75,977,776 Q126R probably benign Het
Speg A T 1: 75,406,926 D1186V probably benign Het
Spink5 T G 18: 43,982,292 M197R probably damaging Het
Stab2 T C 10: 86,861,499 D1975G probably benign Het
Syngap1 T A 17: 26,957,411 C224* probably null Het
Ttn T C 2: 76,868,463 probably benign Het
Txnrd1 G A 10: 82,885,282 E397K probably benign Het
Ugt2b36 A T 5: 87,089,485 M313K probably damaging Het
Ulk3 A G 9: 57,590,441 I74V possibly damaging Het
Zcchc4 T C 5: 52,796,231 V194A probably damaging Het
Zfp27 C T 7: 29,896,367 A58T possibly damaging Het
Zfp398 T G 6: 47,866,945 *512E probably null Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7758:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
R7845:Rbp3 UTSW 14 33956464 missense probably benign 0.24
R8176:Rbp3 UTSW 14 33955648 missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33956363 missense probably benign 0.00
Z1177:Rbp3 UTSW 14 33954538 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CGAAGAGTTTGCCTTCCTCATG -3'
(R):5'- TCCCCAGGGCTATGGAATAC -3'

Sequencing Primer
(F):5'- ACTGGTCGGCGAAATCAC -3'
(R):5'- TGGAATACCAGCAGGCGGTG -3'
Posted On2014-12-04