Incidental Mutation 'R2497:Tectb'
ID251131
Institutional Source Beutler Lab
Gene Symbol Tectb
Ensembl Gene ENSMUSG00000024979
Gene Nametectorin beta
Synonyms[b]-tectorin, Tctnb
MMRRC Submission 040411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2497 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location55180733-55196313 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to G at 55180999 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025936] [ENSMUST00000120936] [ENSMUST00000154886]
Predicted Effect probably benign
Transcript: ENSMUST00000025936
SMART Domains Protein: ENSMUSP00000025936
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 283 3.47e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120936
SMART Domains Protein: ENSMUSP00000113805
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 293 1.9e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154886
SMART Domains Protein: ENSMUSP00000121767
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 196 6.19e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-collagenous glycoprotein component of the tectorial membrane, which covers the auditory hair cells in the cochlea of the inner ear. A similar protein in mouse functions in low-frequency hearing. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null allele show an enlarged tectorial membrane with a disrupted striated-sheet matrix, absence of the marginal band, and low-frequency hearing loss. However, basilar-membrane and neural tuning are both enhanced in high-frequency cochlear regions, with little loss in sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,267 probably benign Het
Acox2 A G 14: 8,251,612 V295A probably benign Het
Agrn T C 4: 156,173,811 E959G probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arhgap39 C A 15: 76,725,385 V1025L probably damaging Het
Atg4d C T 9: 21,273,386 R459* probably null Het
Atp11b A G 3: 35,855,145 S1163G probably damaging Het
Atp13a5 G T 16: 29,339,071 S173* probably null Het
Atp6v1g2 T A 17: 35,236,786 I8N probably damaging Het
Ccdc77 C T 6: 120,325,472 G430R possibly damaging Het
Cdc34b A G 11: 94,742,381 T136A probably benign Het
Cdkal1 A G 13: 29,474,541 S23P unknown Het
Cdkl2 T A 5: 92,008,998 H566L probably benign Het
Cers6 T C 2: 69,071,446 probably benign Het
Clspn A G 4: 126,572,347 T557A possibly damaging Het
Cmya5 T C 13: 93,098,005 T192A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah17 T G 11: 118,087,024 probably null Het
Dnah8 C T 17: 30,741,365 Q2239* probably null Het
Dscaml1 T C 9: 45,745,078 V1572A probably benign Het
Elfn2 C G 15: 78,674,264 E28Q probably damaging Het
Enam T A 5: 88,502,694 N687K probably benign Het
Flywch1 G A 17: 23,755,711 R652W probably benign Het
Gm5612 T C 9: 18,427,679 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Mmp3 A G 9: 7,450,131 T288A probably benign Het
Mtmr4 T A 11: 87,600,823 F168L probably damaging Het
Myo1d T A 11: 80,674,821 N393Y probably damaging Het
Nacc2 A T 2: 26,089,568 Y285* probably null Het
Nf1 G T 11: 79,443,884 G844V probably damaging Het
Nox4 T A 7: 87,295,876 Y113* probably null Het
Pcdha3 T C 18: 36,947,503 C433R probably benign Het
Pde6c A G 19: 38,153,694 I358V probably damaging Het
Pdgfrb A T 18: 61,078,628 D819V possibly damaging Het
Phf3 C A 1: 30,830,014 R651L probably damaging Het
Prrx1 A G 1: 163,248,265 V244A possibly damaging Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rab27a T C 9: 73,084,981 L97P probably damaging Het
Rnf20 G A 4: 49,652,676 probably null Het
Sdad1 T C 5: 92,300,099 N259S probably benign Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc1a4 T C 11: 20,332,620 probably benign Het
Smyd2 T A 1: 189,885,337 N300I possibly damaging Het
Snd1 A G 6: 28,888,079 I875V probably benign Het
Ssh1 T C 5: 113,958,858 N174S probably damaging Het
Tanc2 T C 11: 105,673,493 probably null Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tpcn1 C T 5: 120,538,998 probably null Het
Unc45b A T 11: 82,936,443 I699F probably damaging Het
Uspl1 C T 5: 149,187,854 P27L probably damaging Het
Wdr66 T C 5: 123,283,369 V98A probably damaging Het
Ylpm1 C G 12: 84,996,761 P91R probably damaging Het
Zdhhc23 G A 16: 43,973,915 T132M probably damaging Het
Zfp148 T C 16: 33,496,385 Y434H probably damaging Het
Zhx2 T C 15: 57,823,155 V640A possibly damaging Het
Other mutations in Tectb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Tectb APN 19 55184013 missense probably damaging 1.00
IGL02001:Tectb APN 19 55189595 missense possibly damaging 0.48
IGL02510:Tectb APN 19 55191511 missense probably damaging 1.00
R0028:Tectb UTSW 19 55194677 missense probably benign 0.01
R0130:Tectb UTSW 19 55181961 missense probably damaging 0.99
R0586:Tectb UTSW 19 55181924 missense probably damaging 1.00
R0598:Tectb UTSW 19 55189586 nonsense probably null
R0655:Tectb UTSW 19 55189870 missense possibly damaging 0.78
R0708:Tectb UTSW 19 55191552 missense probably benign 0.37
R1314:Tectb UTSW 19 55183985 missense probably damaging 1.00
R1999:Tectb UTSW 19 55180999 start gained probably benign
R2000:Tectb UTSW 19 55180999 start gained probably benign
R2024:Tectb UTSW 19 55181929 missense probably damaging 1.00
R2148:Tectb UTSW 19 55180999 start gained probably benign
R2159:Tectb UTSW 19 55180999 start gained probably benign
R2160:Tectb UTSW 19 55180999 start gained probably benign
R2161:Tectb UTSW 19 55180999 start gained probably benign
R2162:Tectb UTSW 19 55180999 start gained probably benign
R2355:Tectb UTSW 19 55180999 start gained probably benign
R2358:Tectb UTSW 19 55180999 start gained probably benign
R2495:Tectb UTSW 19 55180999 start gained probably benign
R2511:Tectb UTSW 19 55180999 start gained probably benign
R2568:Tectb UTSW 19 55180999 start gained probably benign
R2570:Tectb UTSW 19 55180999 start gained probably benign
R2848:Tectb UTSW 19 55180999 start gained probably benign
R2897:Tectb UTSW 19 55180999 start gained probably benign
R2898:Tectb UTSW 19 55180999 start gained probably benign
R3712:Tectb UTSW 19 55180999 start gained probably benign
R5671:Tectb UTSW 19 55192627 missense probably benign 0.42
R5875:Tectb UTSW 19 55189626 missense possibly damaging 0.94
R6312:Tectb UTSW 19 55192662 frame shift probably null
R6315:Tectb UTSW 19 55191472 missense possibly damaging 0.73
R6366:Tectb UTSW 19 55181918 missense probably damaging 1.00
R7729:Tectb UTSW 19 55192672 missense
Predicted Primers PCR Primer
(F):5'- GGTACAAGCTCAGGACAGCATC -3'
(R):5'- ACTGGGGACTTCTGTTCCTC -3'

Sequencing Primer
(F):5'- TCACCGAGCTCTCTTGGAAAC -3'
(R):5'- TTTCCTAACCAAGCCATCACAGAG -3'
Posted On2014-12-04