Incidental Mutation 'R2496:Tmem70'
ID251133
Institutional Source Beutler Lab
Gene Symbol Tmem70
Ensembl Gene ENSMUSG00000025940
Gene Nametransmembrane protein 70
Synonyms
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2496 (G1)
Quality Score205
Status Not validated
Chromosome1
Chromosomal Location16665207-16678275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 16665351 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 15 (P15Q)
Ref Sequence ENSEMBL: ENSMUSP00000070497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065373] [ENSMUST00000177501]
Predicted Effect probably benign
Transcript: ENSMUST00000065373
AA Change: P15Q

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000070497
Gene: ENSMUSG00000025940
AA Change: P15Q

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:DUF1301 102 234 1.3e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176451
Predicted Effect probably benign
Transcript: ENSMUST00000177501
AA Change: P15Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135483
Gene: ENSMUSG00000025940
AA Change: P15Q

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:TMEM70 104 235 2.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186738
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality during organogenesis associated with severe growth delay, impaired biosynthesis and assembly of ATP synthase, decreased ATP production, oxidative stress, delayed heart development, and altered mitochondrial ultrastructure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Tmem70
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1856:Tmem70 UTSW 1 16677273 missense probably damaging 1.00
R3040:Tmem70 UTSW 1 16667765 missense possibly damaging 0.47
R5853:Tmem70 UTSW 1 16665332 missense possibly damaging 0.96
R5939:Tmem70 UTSW 1 16677391 missense probably benign 0.00
R6707:Tmem70 UTSW 1 16677307 missense probably damaging 1.00
R6942:Tmem70 UTSW 1 16677156 missense probably damaging 1.00
R7260:Tmem70 UTSW 1 16665366 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TCATTTGCTGCCTGGAACC -3'
(R):5'- TTCGAAAGGAGAATCAATCCCTG -3'

Sequencing Primer
(F):5'- GCATTTTCTGCGCACGCG -3'
(R):5'- ATCCCTGGATTGACAGCAGCTG -3'
Posted On2014-12-04