Mutagenetix > Incidental Mutations

Incidental Mutation 'R2496:Mtf1'

251165

Institutional Source

Beutler Lab

Gene Symbol

Mtf1

Ensembl Gene

ENSMUSG00000028890

Gene Name

metal response element binding transcription factor 1

Synonyms

Thyls, metalloregulatory transcription factor, MTF-1, metal response element-binding transcription factor 1

MMRRC Submission

040410-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2496 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124802104-124849800 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124838904 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 585 (N585S)

Ref Sequence

ENSEMBL: ENSMUSP00000101799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030723] [ENSMUST00000106193]

Predicted Effect

probably benign
Transcript: ENSMUST00000030723
AA Change: N585S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000030723
Gene: ENSMUSG00000028890
AA Change: N585S

Domain	Start	End	E-Value	Type
ZnF_C2H2	139	163	1.22e-4	SMART
ZnF_C2H2	169	193	6.42e-4	SMART
ZnF_C2H2	199	223	2.4e-3	SMART
ZnF_C2H2	228	252	2.57e-3	SMART
ZnF_C2H2	258	282	2.57e-3	SMART
ZnF_C2H2	288	312	7.37e-4	SMART
low complexity region	429	456	N/A	INTRINSIC
low complexity region	500	526	N/A	INTRINSIC
low complexity region	545	558	N/A	INTRINSIC
low complexity region	628	638	N/A	INTRINSIC
low complexity region	656	669	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106193
AA Change: N585S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000101799
Gene: ENSMUSG00000028890
AA Change: N585S

Domain	Start	End	E-Value	Type
ZnF_C2H2	139	163	1.22e-4	SMART
ZnF_C2H2	169	193	6.42e-4	SMART
ZnF_C2H2	199	223	2.4e-3	SMART
ZnF_C2H2	228	252	2.57e-3	SMART
ZnF_C2H2	258	282	2.57e-3	SMART
ZnF_C2H2	288	312	7.37e-4	SMART
low complexity region	429	456	N/A	INTRINSIC
low complexity region	500	526	N/A	INTRINSIC
low complexity region	545	558	N/A	INTRINSIC
low complexity region	628	638	N/A	INTRINSIC
low complexity region	656	669	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation show impaired hepatocyte development followed by embryonic liver degeneration, generalized edema, and death at ~14 days of gestation. Mutant embryonic fibroblasts show increased susceptibility to the cytotoxiceffects of cadmium and hydrogen peroxide. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,256,491	V391A	possibly damaging	Het
Acan	T	C	7: 79,111,317	W1926R	probably damaging	Het
AI464131	A	G	4: 41,499,165	V155A	probably benign	Het
Arhgef25	T	C	10: 127,187,194	T106A	probably benign	Het
Baz1b	G	A	5: 135,210,775	R243Q	probably damaging	Het
Cdhr3	A	G	12: 33,049,069	Y508H	probably benign	Het
Cyp2d9	T	A	15: 82,452,479	W10R	probably damaging	Het
Dmxl1	A	G	18: 49,880,791	T1549A	possibly damaging	Het
Dnah8	A	T	17: 30,851,731	R4464W	probably damaging	Het
Dpp4	G	A	2: 62,387,133	T40M	possibly damaging	Het
Dync1h1	A	G	12: 110,641,220	H2723R	possibly damaging	Het
E2f3	C	T	13: 29,911,306	S333N	probably damaging	Het
Fam120a	G	T	13: 48,967,593	A79E	probably damaging	Het
Fat3	A	G	9: 15,966,103	S3405P	probably benign	Het
Gaa	T	C	11: 119,283,705	S793P	possibly damaging	Het
Galc	A	C	12: 98,227,281	F350V	probably damaging	Het
Gm136	A	G	4: 34,746,541	C157R	probably damaging	Het
Gm3327	A	C	14: 44,126,263	N108T	unknown	Het
H2-M10.2	A	G	17: 36,285,879	Y102H	possibly damaging	Het
Hmcn1	A	T	1: 150,615,221	D4192E	probably benign	Het
Hpse2	A	C	19: 43,013,043		probably null	Het
Idh3a	T	C	9: 54,603,349	V362A	probably benign	Het
Kdm7a	A	T	6: 39,170,763		probably null	Het
Krt6b	A	G	15: 101,679,781	V148A	probably damaging	Het
Lrba	G	A	3: 86,532,087	R1977H	probably damaging	Het
Magi2	A	T	5: 19,678,752	Y134F	probably benign	Het
Mamdc4	T	C	2: 25,565,902	Y801C	probably damaging	Het
Maml1	T	C	11: 50,258,544	T790A	probably benign	Het
Map3k19	A	G	1: 127,823,086	Y843H	probably damaging	Het
Mdfic	A	T	6: 15,741,042	H45L	possibly damaging	Het
Mlx	C	T	11: 101,088,254	T87I	probably benign	Het
Mms22l	T	A	4: 24,521,269	I382K	probably benign	Het
Mylk2	C	T	2: 152,913,668	P251S	probably damaging	Het
Nox4	A	T	7: 87,306,750	T157S	probably benign	Het
Oas2	A	T	5: 120,748,617	H161Q	probably benign	Het
Obscn	A	T	11: 59,103,442	V1563E	probably damaging	Het
Olfr133	T	C	17: 38,149,431	V281A	possibly damaging	Het
Olfr543	T	C	7: 102,477,147	K241R	probably damaging	Het
Olfr772	A	C	10: 129,174,097	F308C	probably benign	Het
Pcdhb11	T	A	18: 37,422,322	I235N	probably benign	Het
Pcsk5	A	T	19: 17,466,158	C1212*	probably null	Het
Ptges	C	T	2: 30,892,710	G110D	possibly damaging	Het
Rsph4a	A	T	10: 33,908,098	I239L	possibly damaging	Het
Setx	A	G	2: 29,144,801	I433V	probably benign	Het
Smyd4	T	C	11: 75,391,101	S467P	probably benign	Het
Snai2	A	T	16: 14,706,002	H10L	possibly damaging	Het
Snw1	T	C	12: 87,450,819	I467V	probably benign	Het
Stab1	A	T	14: 31,161,463	C301S	probably damaging	Het
Tax1bp1	T	A	6: 52,758,357		probably null	Het
Tmem70	C	A	1: 16,665,351	P15Q	probably benign	Het
Tmem87a	T	C	2: 120,394,378	E134G	probably damaging	Het
Ubr4	C	T	4: 139,473,205		probably benign	Het
Ugt2b37	C	T	5: 87,254,710	V21M	probably damaging	Het
Ugt2b38	T	A	5: 87,421,692	I259F	probably damaging	Het
Zfp804a	T	A	2: 82,235,844	L53Q	probably damaging	Het

Other mutations in Mtf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01902:Mtf1	APN	4	124804927	missense	probably damaging	0.99
IGL02491:Mtf1	APN	4	124838579	missense	probably benign	0.00
IGL02493:Mtf1	APN	4	124821319	missense	probably damaging	1.00
IGL02644:Mtf1	APN	4	124820235	missense	probably damaging	1.00
IGL02661:Mtf1	APN	4	124825109	missense	probably damaging	0.98
IGL03018:Mtf1	APN	4	124838663	missense	probably benign	0.44
LCD18:Mtf1	UTSW	4	124829316	intron	probably benign
R0443:Mtf1	UTSW	4	124824282	unclassified	probably benign
R0599:Mtf1	UTSW	4	124820201	splice site	probably benign
R1103:Mtf1	UTSW	4	124838468	missense	probably benign	0.28
R4258:Mtf1	UTSW	4	124838783	missense	probably benign	0.00
R4818:Mtf1	UTSW	4	124804712	start codon destroyed	probably null	1.00
R5085:Mtf1	UTSW	4	124821308	missense	probably damaging	1.00
R5248:Mtf1	UTSW	4	124820427	missense	probably damaging	1.00
R5368:Mtf1	UTSW	4	124825079	missense	probably damaging	0.98
R6368:Mtf1	UTSW	4	124824352	missense	probably damaging	1.00
R6768:Mtf1	UTSW	4	124837785	missense	probably benign	0.01
R7417:Mtf1	UTSW	4	124825181	missense	probably null	0.00
R7559:Mtf1	UTSW	4	124820206	missense	probably damaging	1.00
R7730:Mtf1	UTSW	4	124838619	missense	possibly damaging	0.49
R7739:Mtf1	UTSW	4	124824288	missense	probably damaging	1.00
X0018:Mtf1	UTSW	4	124838847	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CACAAAGTACTACTGAGCCCCTG -3'
(R):5'- CTCCCCTGGATCTGCAATAC -3'

Sequencing Primer
(F):5'- TGCCTGCTATGGTCCAGAC -3'
(R):5'- ACTCAGTGGTAAGCACTTGC -3'

Posted On

2014-12-04