Incidental Mutation 'R2496:Snw1'
ID251217
Institutional Source Beutler Lab
Gene Symbol Snw1
Ensembl Gene ENSMUSG00000021039
Gene NameSNW domain containing 1
SynonymsSkiip, SKIP, NCoA-62, 2310008B08Rik, SNW1
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R2496 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location87449075-87472274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87450819 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 467 (I467V)
Ref Sequence ENSEMBL: ENSMUSP00000021428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021428] [ENSMUST00000021428] [ENSMUST00000077462] [ENSMUST00000160488] [ENSMUST00000161023]
Predicted Effect probably benign
Transcript: ENSMUST00000021428
AA Change: I467V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021428
Gene: ENSMUSG00000021039
AA Change: I467V

DomainStartEndE-ValueType
Pfam:SKIP_SNW 175 335 2e-78 PFAM
low complexity region 524 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021428
AA Change: I467V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021428
Gene: ENSMUSG00000021039
AA Change: I467V

DomainStartEndE-ValueType
Pfam:SKIP_SNW 175 335 2e-78 PFAM
low complexity region 524 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077462
SMART Domains Protein: ENSMUSP00000076673
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 18 82 1.08e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160488
SMART Domains Protein: ENSMUSP00000124174
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 20 92 2.41e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160880
SMART Domains Protein: ENSMUSP00000125727
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
Blast:RRM 15 47 6e-17 BLAST
SCOP:d1u2fa_ 17 59 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161023
SMART Domains Protein: ENSMUSP00000125341
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 20 92 1.73e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222579
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNW gene family, encodes a coactivator that enhances transcription from some Pol II promoters. This coactivator can bind to the ligand-binding domain of the vitamin D receptor and to retinoid receptors to enhance vitamin D-, retinoic acid-, estrogen-, and glucocorticoid-mediated gene expression. It can also function as a splicing factor by interacting with poly(A)-binding protein 2 to directly control the expression of muscle-specific genes at the transcriptional level. Finally, the protein may be involved in oncogenesis since it interacts with a region of SKI oncoproteins that is required for transforming activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Snw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Snw1 APN 12 87452580 critical splice donor site probably null
IGL00559:Snw1 APN 12 87468731 missense probably damaging 0.98
IGL00561:Snw1 APN 12 87450804 critical splice donor site probably null
IGL01019:Snw1 APN 12 87450941 missense probably benign 0.24
IGL01304:Snw1 APN 12 87453915 missense possibly damaging 0.71
IGL01918:Snw1 APN 12 87455668 missense probably benign 0.14
IGL03170:Snw1 APN 12 87472252 missense probably benign 0.00
R0149:Snw1 UTSW 12 87461917 missense possibly damaging 0.51
R1760:Snw1 UTSW 12 87464689 missense probably benign 0.06
R1935:Snw1 UTSW 12 87459477 missense probably damaging 1.00
R2130:Snw1 UTSW 12 87452703 unclassified probably benign
R2230:Snw1 UTSW 12 87452658 missense probably benign 0.00
R4907:Snw1 UTSW 12 87459489 missense probably benign 0.19
R4926:Snw1 UTSW 12 87452658 missense probably benign 0.00
R5138:Snw1 UTSW 12 87460435 missense probably benign 0.00
R5447:Snw1 UTSW 12 87455715 missense probably benign 0.19
R6239:Snw1 UTSW 12 87464628 missense probably damaging 1.00
R6552:Snw1 UTSW 12 87459419 critical splice donor site probably null
R6747:Snw1 UTSW 12 87464710 missense probably damaging 1.00
R7230:Snw1 UTSW 12 87464554 missense probably damaging 1.00
R7242:Snw1 UTSW 12 87468645 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATCCTCCTCAAACTGCACTGG -3'
(R):5'- CCTAAGTATTCAGATCCAGCTTTG -3'

Sequencing Primer
(F):5'- AAACTGCACTGGTCCTTCTCGG -3'
(R):5'- GACAGTGGATTTGCAGGT -3'
Posted On2014-12-04