Incidental Mutation 'R2697:Rfng'
ID251218
Institutional Source Beutler Lab
Gene Symbol Rfng
Ensembl Gene ENSMUSG00000025158
Gene NameRFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymsradical fringe
MMRRC Submission 040435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2697 (G1)
Quality Score219
Status Not validated
Chromosome11
Chromosomal Location120780746-120784207 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 120784039 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026156] [ENSMUST00000100134] [ENSMUST00000116305] [ENSMUST00000153678] [ENSMUST00000172809] [ENSMUST00000208737]
Predicted Effect unknown
Transcript: ENSMUST00000026156
AA Change: D42Y
SMART Domains Protein: ENSMUSP00000026156
Gene: ENSMUSG00000025158
AA Change: D42Y

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 54 306 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100134
SMART Domains Protein: ENSMUSP00000097711
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 4.9e-78 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116305
SMART Domains Protein: ENSMUSP00000112007
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 1.3e-77 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144519
Predicted Effect probably benign
Transcript: ENSMUST00000153678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156723
Predicted Effect probably benign
Transcript: ENSMUST00000172809
SMART Domains Protein: ENSMUSP00000133855
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:RPN7 162 344 8.8e-77 PFAM
PINT 395 478 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208737
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display a completely normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,656 S46G unknown Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam7 A T 14: 68,514,783 C417* probably null Het
Adgrl4 A C 3: 151,510,623 Q481P probably damaging Het
Adra2c C A 5: 35,280,698 N271K probably benign Het
Ahctf1 T C 1: 179,752,532 K2035R probably damaging Het
Ano3 T C 2: 110,794,960 T182A possibly damaging Het
Armc3 T C 2: 19,303,935 Y805H probably damaging Het
BC024139 TCCACCACCACCACCACCAC TCCACCACCACCACCAC 15: 76,120,193 probably benign Het
Cabp7 C T 11: 4,738,837 R211H probably damaging Het
Ccdc117 T C 11: 5,534,888 N112S possibly damaging Het
Cep120 C T 18: 53,740,125 D45N probably benign Het
Cpsf1 T C 15: 76,599,329 Y872C probably damaging Het
Cradd A G 10: 95,175,945 L111P probably damaging Het
Crhr2 A G 6: 55,102,830 L155P probably damaging Het
Fam46a T C 9: 85,324,740 D335G possibly damaging Het
Fgd2 A T 17: 29,376,921 T518S probably damaging Het
Gm340 T A 19: 41,584,027 V407E probably benign Het
Gpam C T 19: 55,083,209 E367K probably damaging Het
Gtf3c1 T A 7: 125,643,954 N1826I probably damaging Het
Kcnq5 T C 1: 21,479,432 E357G probably damaging Het
Krt1 T A 15: 101,846,929 D465V probably damaging Het
Macrod1 T C 19: 7,196,792 V221A probably damaging Het
Mbd1 T C 18: 74,273,617 S144P possibly damaging Het
Mtfmt T C 9: 65,452,021 V326A probably benign Het
Myo1b T C 1: 51,863,358 D71G probably benign Het
Myo1h A G 5: 114,355,213 Y705C probably damaging Het
Nudt9 T C 5: 104,064,993 W311R probably damaging Het
Olfr132 A G 17: 38,131,009 F61S probably damaging Het
Olfr47 A T 6: 43,236,126 I173F probably damaging Het
Olfr743 C T 14: 50,533,781 A123V probably damaging Het
Olfr808 G A 10: 129,767,924 V143I probably benign Het
Osbp2 A T 11: 3,863,407 L154Q probably benign Het
P3h1 A G 4: 119,247,180 T633A probably damaging Het
Polq T G 16: 37,042,153 L616R probably damaging Het
Pon3 A G 6: 5,232,429 L197S possibly damaging Het
Rap1gds1 C T 3: 138,983,721 probably null Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rps6ka2 T G 17: 7,300,322 L728R probably benign Het
Slc41a3 C A 6: 90,642,320 N360K possibly damaging Het
Sult1e1 T C 5: 87,578,538 N239S probably damaging Het
Tacr1 T A 6: 82,492,597 I154N probably damaging Het
Tacstd2 T A 6: 67,535,219 H163L probably benign Het
Tiam1 T C 16: 89,793,164 S1382G probably benign Het
Tmem43 A G 6: 91,479,929 E164G possibly damaging Het
U2af2 G A 7: 5,067,546 R78H probably benign Het
Yipf7 T A 5: 69,541,140 D8V possibly damaging Het
Zfp58 G A 13: 67,491,005 H456Y probably damaging Het
Zfp799 G A 17: 32,820,240 R351* probably null Het
Zfyve9 T C 4: 108,695,819 D715G probably damaging Het
Other mutations in Rfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Rfng APN 11 120783952 missense probably damaging 0.99
IGL01073:Rfng APN 11 120783921 missense probably benign 0.01
IGL01748:Rfng APN 11 120783743 missense probably benign 0.00
R1533:Rfng UTSW 11 120781861 nonsense probably null
R4169:Rfng UTSW 11 120783946 missense probably benign 0.10
R4401:Rfng UTSW 11 120782480 missense possibly damaging 0.94
R4613:Rfng UTSW 11 120782650 missense probably damaging 1.00
R4738:Rfng UTSW 11 120783964 missense probably damaging 1.00
R5015:Rfng UTSW 11 120783050 missense probably damaging 0.98
R5703:Rfng UTSW 11 120782016 missense probably benign 0.40
R6191:Rfng UTSW 11 120782690 missense probably damaging 1.00
R8345:Rfng UTSW 11 120784075 missense unknown
R8846:Rfng UTSW 11 120784146 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGGTGAAAATGAACGTCTGTGG -3'
(R):5'- TGTCACTCTTAAAGGGGCCG -3'

Sequencing Primer
(F):5'- CGTCTGTGGGAGAAAACGCC -3'
(R):5'- GCGATCGCATGAGCCGT -3'
Posted On2014-12-04