Incidental Mutation 'R0309:Triobp'
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission 038519-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0309 (G1)
Quality Score208
Status Validated
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78976540 bp
Amino Acid Change Aspartic acid to Glycine at position 1389 (D1389G)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000229270]
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: D1389G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: D1389G

low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109690
AA Change: D1389G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: D1389G

low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,259 D133G possibly damaging Het
Abcb4 A C 5: 8,939,835 D796A probably damaging Het
Actg2 A T 6: 83,519,914 V147E probably damaging Het
Adamts13 A C 2: 26,986,989 T534P probably damaging Het
Ago1 T C 4: 126,443,166 T249A probably benign Het
Ahnak T A 19: 9,002,495 I381N probably damaging Het
Akap9 A G 5: 4,069,038 D3515G probably benign Het
Angptl3 T C 4: 99,034,469 V249A probably benign Het
Ank A G 15: 27,567,572 T294A possibly damaging Het
Ank1 A T 8: 23,104,809 H204L probably damaging Het
Apbb2 A G 5: 66,310,988 probably benign Het
Arhgap28 A T 17: 67,901,429 S15T probably benign Het
Aspm T C 1: 139,482,511 probably benign Het
Atp1a4 T C 1: 172,234,987 E651G probably damaging Het
B3gnt2 A T 11: 22,836,860 F109L probably damaging Het
Bpifb4 T C 2: 153,959,683 F575L probably damaging Het
Calr C A 8: 84,843,031 K322N probably benign Het
Ccdc188 T C 16: 18,219,305 S247P possibly damaging Het
Cdr1 T A X: 61,185,302 D86V unknown Het
Cep97 C T 16: 55,925,058 V48I probably damaging Het
Chaf1b T A 16: 93,884,511 C6S probably damaging Het
Chd3 C T 11: 69,357,018 D920N probably damaging Het
Clk1 T C 1: 58,413,033 probably benign Het
Cntnap3 T A 13: 64,757,436 probably benign Het
Col12a1 T A 9: 79,600,011 probably null Het
Col17a1 G T 19: 47,671,362 probably benign Het
Coq7 T A 7: 118,529,717 I32F possibly damaging Het
Cox6a2 A T 7: 128,205,935 F59I probably damaging Het
Cpq A G 15: 33,594,151 D436G probably damaging Het
Ctso G A 3: 81,944,861 probably null Het
Cxadr A T 16: 78,334,948 H274L probably benign Het
Cyp2c40 A T 19: 39,778,051 C367S possibly damaging Het
Cyp2c70 T G 19: 40,160,671 M344L possibly damaging Het
Defa35 G A 8: 21,065,855 V77I probably benign Het
Dhx57 A G 17: 80,274,881 Y432H probably damaging Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah7a C G 1: 53,405,690 D3952H probably damaging Het
Dnah9 C A 11: 66,026,972 probably benign Het
Dstyk C A 1: 132,456,864 probably benign Het
Efcab2 T A 1: 178,475,904 probably benign Het
Ehbp1l1 T C 19: 5,720,570 E287G possibly damaging Het
Epgn A G 5: 91,032,214 T87A probably benign Het
Erc2 A C 14: 28,141,225 E803A probably damaging Het
Fam26d A G 10: 34,044,047 W75R probably damaging Het
Fer A G 17: 64,139,016 *454W probably null Het
Glyr1 T C 16: 5,031,972 D179G probably damaging Het
Gm12830 T A 4: 114,844,976 probably benign Het
Gm14085 A T 2: 122,517,553 T253S probably benign Het
Gm9922 C A 14: 101,729,693 probably benign Het
Gsta3 C T 1: 21,264,894 P200S possibly damaging Het
Hmgxb3 G A 18: 61,155,128 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il16 T C 7: 83,722,554 K15E probably damaging Het
Kcnip2 T A 19: 45,794,075 probably benign Het
Kdm4c T C 4: 74,345,567 V696A probably benign Het
Kdr A G 5: 75,946,927 probably benign Het
Klhl33 T G 14: 50,891,411 H787P probably damaging Het
Klk14 A T 7: 43,694,345 T159S probably benign Het
Lancl2 A G 6: 57,703,132 N16D probably damaging Het
Lemd3 T C 10: 120,937,110 N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,271,015 probably null Het
Mpl T G 4: 118,446,038 probably benign Het
Myh7b T C 2: 155,630,672 probably benign Het
Mylk A C 16: 34,912,297 probably benign Het
Myof A T 19: 37,981,266 M316K probably benign Het
Nfib T A 4: 82,296,737 N543I probably damaging Het
Nfix A G 8: 84,721,774 S375P probably damaging Het
Nkrf T C X: 36,890,116 Q171R probably damaging Het
Nmnat2 T A 1: 153,077,001 probably benign Het
Npffr2 G A 5: 89,583,347 E379K probably benign Het
Npr2 T C 4: 43,640,904 probably benign Het
Nup98 A C 7: 102,152,428 D212E probably null Het
Nwd2 T C 5: 63,807,218 Y1382H probably damaging Het
Ocstamp T C 2: 165,395,992 R451G possibly damaging Het
Olfr593 T A 7: 103,212,721 I287K probably damaging Het
Olfr804 A G 10: 129,705,139 D87G probably benign Het
Pabpc1 C T 15: 36,597,493 A551T possibly damaging Het
Papd7 A T 13: 69,499,932 V781E possibly damaging Het
Pard3 A T 8: 127,376,897 probably benign Het
Pcdhb12 G T 18: 37,436,121 V107L probably benign Het
Pik3cd A T 4: 149,663,220 V22D probably damaging Het
Pkd1l2 A G 8: 116,997,576 V2396A probably damaging Het
Pnpla7 T C 2: 24,987,195 I167T probably damaging Het
Pphln1 A T 15: 93,441,707 H114L possibly damaging Het
Ppm1h A G 10: 122,920,782 N444S probably damaging Het
Prdm9 G A 17: 15,557,384 T146I probably damaging Het
Prrc2a A G 17: 35,150,915 probably benign Het
Prrx1 T C 1: 163,312,559 D26G possibly damaging Het
Ptpn5 T C 7: 47,079,294 E495G probably damaging Het
Rab23 A C 1: 33,734,861 probably null Het
Ralgps1 C T 2: 33,157,923 M348I probably benign Het
Ranbp2 A G 10: 58,479,868 T2137A probably benign Het
Rapgef4 G T 2: 72,226,030 G654V probably benign Het
Rc3h2 A T 2: 37,379,008 probably benign Het
Reg2 G A 6: 78,406,186 A39T possibly damaging Het
Sema4d C A 13: 51,725,311 V7F probably benign Het
Sgip1 T C 4: 102,915,157 probably benign Het
Sgpl1 C T 10: 61,113,437 probably null Het
Shisa9 G A 16: 11,997,123 V212M probably damaging Het
Shq1 G A 6: 100,573,627 P450L probably benign Het
Sin3a A G 9: 57,110,912 T872A probably benign Het
Sipa1l3 C T 7: 29,348,350 R1371Q probably benign Het
Skint8 T C 4: 111,938,867 V246A probably benign Het
Slc22a20 A T 19: 5,972,957 V386D probably damaging Het
Slc2a7 G A 4: 150,158,071 probably benign Het
Slc35a2 T A X: 7,889,662 Y48N probably damaging Het
Slc4a2 G T 5: 24,434,346 S413I probably damaging Het
Sntg2 T C 12: 30,226,773 T427A probably benign Het
Soat1 T C 1: 156,442,453 Y132C probably damaging Het
Stn1 G T 19: 47,501,673 H342N probably benign Het
Tarbp1 T A 8: 126,438,928 probably benign Het
Tas2r113 A C 6: 132,893,378 K123T probably damaging Het
Tbck C T 3: 132,734,407 Q504* probably null Het
Tenm3 C T 8: 48,341,034 C380Y probably damaging Het
Trpm4 A T 7: 45,308,706 F780I probably damaging Het
Tubb4a G T 17: 57,081,182 Y281* probably null Het
Txndc15 T C 13: 55,724,582 F261S probably damaging Het
Ube3b T C 5: 114,419,469 probably benign Het
Unc5c G C 3: 141,733,933 V196L probably benign Het
Upf3a G A 8: 13,795,500 probably null Het
Vmn2r20 T C 6: 123,386,104 K574E probably benign Het
Vps50 A G 6: 3,536,853 M275V possibly damaging Het
Xrcc5 A G 1: 72,307,576 probably benign Het
Zbtb18 T C 1: 177,448,616 L505S probably damaging Het
Zbtb41 T C 1: 139,438,984 I567T probably damaging Het
Zfp598 T C 17: 24,678,584 probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8446:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8448:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8469:Triobp UTSW 15 78967019 missense probably benign 0.00
R8491:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8492:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8493:Triobp UTSW 15 78994126 missense possibly damaging 0.85
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcttttcttcctttcttccttctttc -3'
Posted On2013-04-16