Mutagenetix > Incidental Mutations

Incidental Mutation 'R2697:Rbp3'

251222

Institutional Source

Beutler Lab

Gene Symbol

Rbp3

Ensembl Gene

ENSMUSG00000041534

Gene Name

retinol binding protein 3, interstitial

Synonyms

Rbp-3, Irbp

MMRRC Submission

040435-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.640) question?

Stock #

R2697 (G1)

Quality Score

189

Status

Not validated

Chromosome

Chromosomal Location

33954003-33964216 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33956018 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 641 (T641M)

Ref Sequence

ENSEMBL: ENSMUSP00000040249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035695]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035695
AA Change: T641M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: T641M

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
TSPc	109	308	5.72e-69	SMART
TSPc	416	616	1.98e-63	SMART
TSPc	720	917	5.34e-69	SMART
TSPc	1019	1216	2.13e-68	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	T	C	6: 132,626,656	S46G	unknown	Het
Acaca	T	A	11: 84,364,413	D1932E	probably damaging	Het
Adam7	A	T	14: 68,514,783	C417*	probably null	Het
Adgrl4	A	C	3: 151,510,623	Q481P	probably damaging	Het
Adra2c	C	A	5: 35,280,698	N271K	probably benign	Het
Ahctf1	T	C	1: 179,752,532	K2035R	probably damaging	Het
Ano3	T	C	2: 110,794,960	T182A	possibly damaging	Het
Armc3	T	C	2: 19,303,935	Y805H	probably damaging	Het
BC024139	TCCACCACCACCACCACCAC	TCCACCACCACCACCAC	15: 76,120,193		probably benign	Het
Cabp7	C	T	11: 4,738,837	R211H	probably damaging	Het
Ccdc117	T	C	11: 5,534,888	N112S	possibly damaging	Het
Cep120	C	T	18: 53,740,125	D45N	probably benign	Het
Cpsf1	T	C	15: 76,599,329	Y872C	probably damaging	Het
Cradd	A	G	10: 95,175,945	L111P	probably damaging	Het
Crhr2	A	G	6: 55,102,830	L155P	probably damaging	Het
Fam46a	T	C	9: 85,324,740	D335G	possibly damaging	Het
Fgd2	A	T	17: 29,376,921	T518S	probably damaging	Het
Gm340	T	A	19: 41,584,027	V407E	probably benign	Het
Gpam	C	T	19: 55,083,209	E367K	probably damaging	Het
Gtf3c1	T	A	7: 125,643,954	N1826I	probably damaging	Het
Kcnq5	T	C	1: 21,479,432	E357G	probably damaging	Het
Krt1	T	A	15: 101,846,929	D465V	probably damaging	Het
Macrod1	T	C	19: 7,196,792	V221A	probably damaging	Het
Mbd1	T	C	18: 74,273,617	S144P	possibly damaging	Het
Mtfmt	T	C	9: 65,452,021	V326A	probably benign	Het
Myo1b	T	C	1: 51,863,358	D71G	probably benign	Het
Myo1h	A	G	5: 114,355,213	Y705C	probably damaging	Het
Nudt9	T	C	5: 104,064,993	W311R	probably damaging	Het
Olfr132	A	G	17: 38,131,009	F61S	probably damaging	Het
Olfr47	A	T	6: 43,236,126	I173F	probably damaging	Het
Olfr743	C	T	14: 50,533,781	A123V	probably damaging	Het
Olfr808	G	A	10: 129,767,924	V143I	probably benign	Het
Osbp2	A	T	11: 3,863,407	L154Q	probably benign	Het
P3h1	A	G	4: 119,247,180	T633A	probably damaging	Het
Polq	T	G	16: 37,042,153	L616R	probably damaging	Het
Pon3	A	G	6: 5,232,429	L197S	possibly damaging	Het
Rap1gds1	C	T	3: 138,983,721		probably null	Het
Rfng	C	A	11: 120,784,039		probably benign	Het
Rps6ka2	T	G	17: 7,300,322	L728R	probably benign	Het
Slc41a3	C	A	6: 90,642,320	N360K	possibly damaging	Het
Sult1e1	T	C	5: 87,578,538	N239S	probably damaging	Het
Tacr1	T	A	6: 82,492,597	I154N	probably damaging	Het
Tacstd2	T	A	6: 67,535,219	H163L	probably benign	Het
Tiam1	T	C	16: 89,793,164	S1382G	probably benign	Het
Tmem43	A	G	6: 91,479,929	E164G	possibly damaging	Het
U2af2	G	A	7: 5,067,546	R78H	probably benign	Het
Yipf7	T	A	5: 69,541,140	D8V	possibly damaging	Het
Zfp58	G	A	13: 67,491,005	H456Y	probably damaging	Het
Zfp799	G	A	17: 32,820,240	R351*	probably null	Het
Zfyve9	T	C	4: 108,695,819	D715G	probably damaging	Het

Other mutations in Rbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Rbp3	APN	14	33954188	missense	possibly damaging	0.82
IGL01643:Rbp3	APN	14	33956836	missense	probably benign	0.18
IGL01665:Rbp3	APN	14	33956131	missense	probably benign	0.02
IGL01809:Rbp3	APN	14	33955300	missense	probably damaging	1.00
IGL01975:Rbp3	APN	14	33958645	missense	probably damaging	1.00
IGL02349:Rbp3	APN	14	33955719	missense	probably damaging	0.97
IGL02447:Rbp3	APN	14	33954503	missense	probably damaging	1.00
IGL03192:Rbp3	APN	14	33958583	missense	possibly damaging	0.52
IGL03302:Rbp3	APN	14	33954659	missense	probably damaging	0.97
Behagt	UTSW	14	33954454	missense	probably benign	0.00
jagt	UTSW	14	33956482	missense	probably damaging	0.97
muntre	UTSW	14	33956356	missense	possibly damaging	0.95
Rotwild	UTSW	14	33956018	missense	probably damaging	1.00
P4717OSA:Rbp3	UTSW	14	33955499	missense	probably damaging	0.96
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0432:Rbp3	UTSW	14	33954773	missense	probably damaging	1.00
R0469:Rbp3	UTSW	14	33962419	missense	possibly damaging	0.95
R0652:Rbp3	UTSW	14	33958648	missense	possibly damaging	0.89
R0739:Rbp3	UTSW	14	33958647	missense	probably benign	0.28
R0747:Rbp3	UTSW	14	33956278	missense	possibly damaging	0.51
R0836:Rbp3	UTSW	14	33956638	missense	possibly damaging	0.84
R1102:Rbp3	UTSW	14	33956356	missense	possibly damaging	0.95
R1583:Rbp3	UTSW	14	33954524	missense	possibly damaging	0.45
R1589:Rbp3	UTSW	14	33955792	missense	probably damaging	0.99
R1595:Rbp3	UTSW	14	33956198	missense	possibly damaging	0.93
R1720:Rbp3	UTSW	14	33956909	missense	probably benign	0.38
R1830:Rbp3	UTSW	14	33954644	missense	probably benign	0.31
R1982:Rbp3	UTSW	14	33954545	missense	probably damaging	0.99
R1985:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R1985:Rbp3	UTSW	14	33956461	missense	probably benign	0.00
R2007:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2027:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2100:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2101:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2113:Rbp3	UTSW	14	33956057	missense	probably benign	0.00
R2138:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2183:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2248:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2277:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2306:Rbp3	UTSW	14	33962563	missense	probably damaging	1.00
R2504:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2696:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2698:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2920:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2940:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2971:Rbp3	UTSW	14	33954454	missense	probably benign	0.00
R3111:Rbp3	UTSW	14	33954112	missense	probably benign	0.01
R3155:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3156:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3751:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3752:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3851:Rbp3	UTSW	14	33955507	missense	probably damaging	0.98
R4016:Rbp3	UTSW	14	33955390	missense	possibly damaging	0.82
R4276:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4277:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4278:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4382:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4383:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4385:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4625:Rbp3	UTSW	14	33956099	missense	probably benign
R4712:Rbp3	UTSW	14	33960658	missense	probably damaging	0.97
R4812:Rbp3	UTSW	14	33954774	missense	probably damaging	0.99
R4918:Rbp3	UTSW	14	33955411	missense	probably damaging	1.00
R4971:Rbp3	UTSW	14	33954470	missense	probably damaging	0.98
R5262:Rbp3	UTSW	14	33954850	missense	probably damaging	1.00
R5387:Rbp3	UTSW	14	33956413	missense	possibly damaging	0.95
R5468:Rbp3	UTSW	14	33956627	missense	possibly damaging	0.93
R5837:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R5994:Rbp3	UTSW	14	33954900	missense	probably damaging	1.00
R6010:Rbp3	UTSW	14	33954647	missense	probably damaging	1.00
R6041:Rbp3	UTSW	14	33956482	missense	probably damaging	0.97
R6266:Rbp3	UTSW	14	33954461	missense	probably benign
R6357:Rbp3	UTSW	14	33957034	missense	probably damaging	0.99
R6457:Rbp3	UTSW	14	33955267	nonsense	probably null
R6777:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R7158:Rbp3	UTSW	14	33955556	missense	probably benign	0.00
R7183:Rbp3	UTSW	14	33955204	missense	probably benign	0.02
R7256:Rbp3	UTSW	14	33962583	missense	possibly damaging	0.93
R7654:Rbp3	UTSW	14	33955840	missense	probably benign
R7756:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7758:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7784:Rbp3	UTSW	14	33954158	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- CCGAAGAGTTTGCCTTCCTC -3'
(R):5'- TCCCCAGGGCTATGGAATAC -3'

Sequencing Primer
(F):5'- GAAGAGTTTGCCTTCCTCATGCAG -3'
(R):5'- TGGAATACCAGCAGGCGGTG -3'

Posted On

2014-12-04