Incidental Mutation 'R2697:Adam7'
Institutional Source Beutler Lab
Gene Symbol Adam7
Ensembl Gene ENSMUSG00000022056
Gene Namea disintegrin and metallopeptidase domain 7
MMRRC Submission 040435-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2697 (G1)
Quality Score225
Status Not validated
Chromosomal Location68497336-68533741 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 68514783 bp
Amino Acid Change Cysteine to Stop codon at position 417 (C417*)
Ref Sequence ENSEMBL: ENSMUSP00000022640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022640]
Predicted Effect probably null
Transcript: ENSMUST00000022640
AA Change: C417*
SMART Domains Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056
AA Change: C417*

Pfam:Pep_M12B_propep 25 156 1.6e-28 PFAM
Pfam:Reprolysin_5 197 378 1.2e-12 PFAM
Pfam:Reprolysin_4 197 382 2.6e-12 PFAM
Pfam:Reprolysin 199 393 1.3e-70 PFAM
Pfam:Reprolysin_2 219 383 1.1e-9 PFAM
Pfam:Reprolysin_3 223 346 9.5e-14 PFAM
DISIN 410 485 8.79e-30 SMART
ACR 486 623 3.51e-58 SMART
transmembrane domain 667 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128069
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,656 S46G unknown Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adgrl4 A C 3: 151,510,623 Q481P probably damaging Het
Adra2c C A 5: 35,280,698 N271K probably benign Het
Ahctf1 T C 1: 179,752,532 K2035R probably damaging Het
Ano3 T C 2: 110,794,960 T182A possibly damaging Het
Armc3 T C 2: 19,303,935 Y805H probably damaging Het
BC024139 TCCACCACCACCACCACCAC TCCACCACCACCACCAC 15: 76,120,193 probably benign Het
Cabp7 C T 11: 4,738,837 R211H probably damaging Het
Ccdc117 T C 11: 5,534,888 N112S possibly damaging Het
Cep120 C T 18: 53,740,125 D45N probably benign Het
Cpsf1 T C 15: 76,599,329 Y872C probably damaging Het
Cradd A G 10: 95,175,945 L111P probably damaging Het
Crhr2 A G 6: 55,102,830 L155P probably damaging Het
Fam46a T C 9: 85,324,740 D335G possibly damaging Het
Fgd2 A T 17: 29,376,921 T518S probably damaging Het
Gm340 T A 19: 41,584,027 V407E probably benign Het
Gpam C T 19: 55,083,209 E367K probably damaging Het
Gtf3c1 T A 7: 125,643,954 N1826I probably damaging Het
Kcnq5 T C 1: 21,479,432 E357G probably damaging Het
Krt1 T A 15: 101,846,929 D465V probably damaging Het
Macrod1 T C 19: 7,196,792 V221A probably damaging Het
Mbd1 T C 18: 74,273,617 S144P possibly damaging Het
Mtfmt T C 9: 65,452,021 V326A probably benign Het
Myo1b T C 1: 51,863,358 D71G probably benign Het
Myo1h A G 5: 114,355,213 Y705C probably damaging Het
Nudt9 T C 5: 104,064,993 W311R probably damaging Het
Olfr132 A G 17: 38,131,009 F61S probably damaging Het
Olfr47 A T 6: 43,236,126 I173F probably damaging Het
Olfr743 C T 14: 50,533,781 A123V probably damaging Het
Olfr808 G A 10: 129,767,924 V143I probably benign Het
Osbp2 A T 11: 3,863,407 L154Q probably benign Het
P3h1 A G 4: 119,247,180 T633A probably damaging Het
Polq T G 16: 37,042,153 L616R probably damaging Het
Pon3 A G 6: 5,232,429 L197S possibly damaging Het
Rap1gds1 C T 3: 138,983,721 probably null Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rfng C A 11: 120,784,039 probably benign Het
Rps6ka2 T G 17: 7,300,322 L728R probably benign Het
Slc41a3 C A 6: 90,642,320 N360K possibly damaging Het
Sult1e1 T C 5: 87,578,538 N239S probably damaging Het
Tacr1 T A 6: 82,492,597 I154N probably damaging Het
Tacstd2 T A 6: 67,535,219 H163L probably benign Het
Tiam1 T C 16: 89,793,164 S1382G probably benign Het
Tmem43 A G 6: 91,479,929 E164G possibly damaging Het
U2af2 G A 7: 5,067,546 R78H probably benign Het
Yipf7 T A 5: 69,541,140 D8V possibly damaging Het
Zfp58 G A 13: 67,491,005 H456Y probably damaging Het
Zfp799 G A 17: 32,820,240 R351* probably null Het
Zfyve9 T C 4: 108,695,819 D715G probably damaging Het
Other mutations in Adam7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Adam7 APN 14 68521938 missense possibly damaging 0.68
IGL01418:Adam7 APN 14 68525206 missense probably benign
IGL01934:Adam7 APN 14 68532599 missense probably damaging 1.00
IGL02655:Adam7 APN 14 68516611 missense probably damaging 1.00
IGL02669:Adam7 APN 14 68507894 missense probably damaging 1.00
PIT4445001:Adam7 UTSW 14 68509748 missense possibly damaging 0.88
R0195:Adam7 UTSW 14 68527627 splice site probably benign
R0277:Adam7 UTSW 14 68510857 splice site probably null
R0362:Adam7 UTSW 14 68509656 splice site probably benign
R0440:Adam7 UTSW 14 68510856 splice site probably null
R0927:Adam7 UTSW 14 68516684 missense probably damaging 1.00
R1172:Adam7 UTSW 14 68514921 missense probably damaging 1.00
R1270:Adam7 UTSW 14 68527669 missense probably damaging 0.98
R1299:Adam7 UTSW 14 68526299 splice site probably benign
R1527:Adam7 UTSW 14 68501521 missense probably benign 0.04
R1543:Adam7 UTSW 14 68521922 splice site probably benign
R1731:Adam7 UTSW 14 68525356 missense probably damaging 1.00
R1732:Adam7 UTSW 14 68498450 missense probably benign 0.00
R1921:Adam7 UTSW 14 68512625 missense possibly damaging 0.55
R2062:Adam7 UTSW 14 68505161 missense probably benign 0.09
R2156:Adam7 UTSW 14 68511343 missense probably benign 0.02
R2353:Adam7 UTSW 14 68505088 missense probably benign 0.01
R4080:Adam7 UTSW 14 68520539 missense probably benign 0.05
R4775:Adam7 UTSW 14 68507912 missense probably benign 0.41
R5202:Adam7 UTSW 14 68507856 missense possibly damaging 0.92
R6006:Adam7 UTSW 14 68511396 missense probably damaging 1.00
R6087:Adam7 UTSW 14 68510757 missense probably damaging 1.00
R6376:Adam7 UTSW 14 68505097 missense possibly damaging 0.78
R6417:Adam7 UTSW 14 68504621 missense probably benign 0.37
R6672:Adam7 UTSW 14 68504702 critical splice acceptor site probably null
R6756:Adam7 UTSW 14 68525279 missense probably benign 0.00
R6777:Adam7 UTSW 14 68525335 missense probably damaging 1.00
R6913:Adam7 UTSW 14 68533651 missense probably benign 0.22
R7127:Adam7 UTSW 14 68514769 critical splice donor site probably null
R7209:Adam7 UTSW 14 68529819 missense probably damaging 1.00
R7399:Adam7 UTSW 14 68504466 splice site probably null
R7675:Adam7 UTSW 14 68499853 missense probably benign 0.07
R7788:Adam7 UTSW 14 68512645 missense possibly damaging 0.62
R7868:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
R8135:Adam7 UTSW 14 68516573 missense probably damaging 1.00
R8281:Adam7 UTSW 14 68507885 missense possibly damaging 0.65
R8507:Adam7 UTSW 14 68526324 missense probably damaging 1.00
Z1176:Adam7 UTSW 14 68527701 missense probably benign 0.26
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-12-04