Incidental Mutation 'R2697:Cpsf1'
ID251228
Institutional Source Beutler Lab
Gene Symbol Cpsf1
Ensembl Gene ENSMUSG00000034022
Gene Namecleavage and polyadenylation specific factor 1
Synonyms
MMRRC Submission 040435-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R2697 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76595803-76607591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76599329 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 872 (Y872C)
Ref Sequence ENSEMBL: ENSMUSP00000155308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000160784] [ENSMUST00000161612] [ENSMUST00000161732] [ENSMUST00000162503] [ENSMUST00000230157] [ENSMUST00000231042]
Predicted Effect probably damaging
Transcript: ENSMUST00000071898
AA Change: Y872C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: Y872C

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160410
Predicted Effect probably benign
Transcript: ENSMUST00000160784
SMART Domains Protein: ENSMUSP00000124666
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 9.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161311
Predicted Effect probably benign
Transcript: ENSMUST00000161612
SMART Domains Protein: ENSMUSP00000124701
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161732
SMART Domains Protein: ENSMUSP00000125482
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162254
Predicted Effect probably benign
Transcript: ENSMUST00000162503
SMART Domains Protein: ENSMUSP00000125055
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 2.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229269
Predicted Effect probably benign
Transcript: ENSMUST00000229287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230149
Predicted Effect probably damaging
Transcript: ENSMUST00000230157
AA Change: Y872C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231037
Predicted Effect probably benign
Transcript: ENSMUST00000231042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231191
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,656 S46G unknown Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam7 A T 14: 68,514,783 C417* probably null Het
Adgrl4 A C 3: 151,510,623 Q481P probably damaging Het
Adra2c C A 5: 35,280,698 N271K probably benign Het
Ahctf1 T C 1: 179,752,532 K2035R probably damaging Het
Ano3 T C 2: 110,794,960 T182A possibly damaging Het
Armc3 T C 2: 19,303,935 Y805H probably damaging Het
BC024139 TCCACCACCACCACCACCAC TCCACCACCACCACCAC 15: 76,120,193 probably benign Het
Cabp7 C T 11: 4,738,837 R211H probably damaging Het
Ccdc117 T C 11: 5,534,888 N112S possibly damaging Het
Cep120 C T 18: 53,740,125 D45N probably benign Het
Cradd A G 10: 95,175,945 L111P probably damaging Het
Crhr2 A G 6: 55,102,830 L155P probably damaging Het
Fam46a T C 9: 85,324,740 D335G possibly damaging Het
Fgd2 A T 17: 29,376,921 T518S probably damaging Het
Gm340 T A 19: 41,584,027 V407E probably benign Het
Gpam C T 19: 55,083,209 E367K probably damaging Het
Gtf3c1 T A 7: 125,643,954 N1826I probably damaging Het
Kcnq5 T C 1: 21,479,432 E357G probably damaging Het
Krt1 T A 15: 101,846,929 D465V probably damaging Het
Macrod1 T C 19: 7,196,792 V221A probably damaging Het
Mbd1 T C 18: 74,273,617 S144P possibly damaging Het
Mtfmt T C 9: 65,452,021 V326A probably benign Het
Myo1b T C 1: 51,863,358 D71G probably benign Het
Myo1h A G 5: 114,355,213 Y705C probably damaging Het
Nudt9 T C 5: 104,064,993 W311R probably damaging Het
Olfr132 A G 17: 38,131,009 F61S probably damaging Het
Olfr47 A T 6: 43,236,126 I173F probably damaging Het
Olfr743 C T 14: 50,533,781 A123V probably damaging Het
Olfr808 G A 10: 129,767,924 V143I probably benign Het
Osbp2 A T 11: 3,863,407 L154Q probably benign Het
P3h1 A G 4: 119,247,180 T633A probably damaging Het
Polq T G 16: 37,042,153 L616R probably damaging Het
Pon3 A G 6: 5,232,429 L197S possibly damaging Het
Rap1gds1 C T 3: 138,983,721 probably null Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rfng C A 11: 120,784,039 probably benign Het
Rps6ka2 T G 17: 7,300,322 L728R probably benign Het
Slc41a3 C A 6: 90,642,320 N360K possibly damaging Het
Sult1e1 T C 5: 87,578,538 N239S probably damaging Het
Tacr1 T A 6: 82,492,597 I154N probably damaging Het
Tacstd2 T A 6: 67,535,219 H163L probably benign Het
Tiam1 T C 16: 89,793,164 S1382G probably benign Het
Tmem43 A G 6: 91,479,929 E164G possibly damaging Het
U2af2 G A 7: 5,067,546 R78H probably benign Het
Yipf7 T A 5: 69,541,140 D8V possibly damaging Het
Zfp58 G A 13: 67,491,005 H456Y probably damaging Het
Zfp799 G A 17: 32,820,240 R351* probably null Het
Zfyve9 T C 4: 108,695,819 D715G probably damaging Het
Other mutations in Cpsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cpsf1 APN 15 76600216 missense probably benign 0.27
IGL01013:Cpsf1 APN 15 76599297 nonsense probably null
IGL01599:Cpsf1 APN 15 76596541 missense probably damaging 1.00
IGL02008:Cpsf1 APN 15 76603091 missense probably damaging 1.00
IGL02291:Cpsf1 APN 15 76602821 missense probably damaging 1.00
IGL02901:Cpsf1 APN 15 76599496 nonsense probably null
IGL02929:Cpsf1 APN 15 76602127 critical splice donor site probably null
IGL03402:Cpsf1 APN 15 76596003 splice site probably null
R0005:Cpsf1 UTSW 15 76600680 critical splice donor site probably null
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0487:Cpsf1 UTSW 15 76597002 missense probably damaging 1.00
R0510:Cpsf1 UTSW 15 76603657 intron probably benign
R0630:Cpsf1 UTSW 15 76601971 missense probably damaging 1.00
R0780:Cpsf1 UTSW 15 76600377 missense probably benign 0.17
R1617:Cpsf1 UTSW 15 76602370 nonsense probably null
R1717:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R1889:Cpsf1 UTSW 15 76602156 missense probably benign 0.06
R1994:Cpsf1 UTSW 15 76603160 missense probably benign 0.03
R2168:Cpsf1 UTSW 15 76603737 missense possibly damaging 0.69
R2359:Cpsf1 UTSW 15 76597673 missense probably benign 0.02
R2847:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R2848:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R3409:Cpsf1 UTSW 15 76601781 nonsense probably null
R3410:Cpsf1 UTSW 15 76601781 nonsense probably null
R3815:Cpsf1 UTSW 15 76601149 missense probably benign 0.22
R4030:Cpsf1 UTSW 15 76601779 missense possibly damaging 0.96
R4491:Cpsf1 UTSW 15 76597722 missense possibly damaging 0.85
R4615:Cpsf1 UTSW 15 76596937 missense possibly damaging 0.88
R5227:Cpsf1 UTSW 15 76598948 missense probably damaging 1.00
R5353:Cpsf1 UTSW 15 76602571 missense probably damaging 1.00
R5548:Cpsf1 UTSW 15 76597327 missense possibly damaging 0.95
R5552:Cpsf1 UTSW 15 76599646 missense probably benign 0.27
R5746:Cpsf1 UTSW 15 76599837 missense probably benign 0.01
R6319:Cpsf1 UTSW 15 76596967 missense probably damaging 1.00
R6360:Cpsf1 UTSW 15 76597455 frame shift probably null
R6572:Cpsf1 UTSW 15 76597455 frame shift probably null
R6574:Cpsf1 UTSW 15 76597455 frame shift probably null
R6576:Cpsf1 UTSW 15 76597455 frame shift probably null
R6577:Cpsf1 UTSW 15 76597455 frame shift probably null
R6588:Cpsf1 UTSW 15 76596822 missense probably damaging 1.00
R6595:Cpsf1 UTSW 15 76602510 missense probably damaging 1.00
R6621:Cpsf1 UTSW 15 76603519 missense probably damaging 1.00
R6880:Cpsf1 UTSW 15 76602539 missense probably benign 0.06
R6954:Cpsf1 UTSW 15 76599496 missense probably damaging 1.00
R7100:Cpsf1 UTSW 15 76596114 missense possibly damaging 0.73
R7255:Cpsf1 UTSW 15 76597543 missense probably damaging 1.00
R7318:Cpsf1 UTSW 15 76597275 nonsense probably null
R7371:Cpsf1 UTSW 15 76600575 missense probably damaging 1.00
R7387:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R7446:Cpsf1 UTSW 15 76601750 missense probably benign
R7612:Cpsf1 UTSW 15 76597009 missense probably benign 0.00
X0052:Cpsf1 UTSW 15 76596302 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTTGGCTTCTTTTCACGGAAG -3'
(R):5'- GCCCACTACACAAGGTGAAG -3'

Sequencing Primer
(F):5'- TCACGGAAGTTGATATTGTGAGGGAC -3'
(R):5'- CTACACAAGGTGAAGTCCGAAAG -3'
Posted On2014-12-04