Incidental Mutation 'R2496:Olfr133'
ID251239
Institutional Source Beutler Lab
Gene Symbol Olfr133
Ensembl Gene ENSMUSG00000063240
Gene Nameolfactory receptor 133
SynonymsGA_x6K02T2PSCP-2597192-2598130, MOR256-6
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2496 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38145281-38151269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38149431 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 281 (V281A)
Ref Sequence ENSEMBL: ENSMUSP00000150597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113636] [ENSMUST00000173610] [ENSMUST00000215078] [ENSMUST00000215549]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113636
AA Change: V281A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109266
Gene: ENSMUSG00000063240
AA Change: V281A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 27 305 3.4e-7 PFAM
Pfam:7tm_4 31 308 6.1e-52 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173610
SMART Domains Protein: ENSMUSP00000133824
Gene: ENSMUSG00000063240

DomainStartEndE-ValueType
Pfam:7tm_1 55 109 3.3e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215078
AA Change: V281A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215549
AA Change: V281A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Olfr133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Olfr133 APN 17 38148855 missense probably benign
IGL02486:Olfr133 APN 17 38149221 missense probably damaging 1.00
IGL02574:Olfr133 APN 17 38149389 missense possibly damaging 0.56
PIT4243001:Olfr133 UTSW 17 38149503 missense probably benign 0.06
PIT4504001:Olfr133 UTSW 17 38149169 missense probably benign
R0726:Olfr133 UTSW 17 38148624 missense probably damaging 1.00
R2242:Olfr133 UTSW 17 38148722 missense possibly damaging 0.87
R4579:Olfr133 UTSW 17 38149405 missense probably damaging 1.00
R5085:Olfr133 UTSW 17 38149112 missense probably damaging 1.00
R6273:Olfr133 UTSW 17 38148942 missense possibly damaging 0.94
R6344:Olfr133 UTSW 17 38148720 missense probably benign 0.01
R7046:Olfr133 UTSW 17 38148800 missense probably benign 0.00
R7090:Olfr133 UTSW 17 38149494 missense probably benign 0.33
R7213:Olfr133 UTSW 17 38149074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCTTGCTCTCTCAGTAGTATGC -3'
(R):5'- CAGATGAGTTTTGTACAGGGAATG -3'

Sequencing Primer
(F):5'- GCCTCCTATGCTAGTATTGGACATG -3'
(R):5'- GTTTTGTACAGGGAATGAATTACAGG -3'
Posted On2014-12-04