Incidental Mutation 'R2697:Fgd2'
ID 251242
Institutional Source Beutler Lab
Gene Symbol Fgd2
Ensembl Gene ENSMUSG00000024013
Gene Name FYVE, RhoGEF and PH domain containing 2
Synonyms Tcd-2, tcs2, Tcd2, tcs-2
MMRRC Submission 040435-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock # R2697 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 29360914-29379660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29376921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 518 (T518S)
Ref Sequence ENSEMBL: ENSMUSP00000024810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024810] [ENSMUST00000123989]
AlphaFold Q8BY35
Predicted Effect probably damaging
Transcript: ENSMUST00000024810
AA Change: T518S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024810
Gene: ENSMUSG00000024013
AA Change: T518S

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
PH 320 420 2.09e-16 SMART
FYVE 450 519 1.07e-28 SMART
PH 545 643 5.09e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123989
SMART Domains Protein: ENSMUSP00000118828
Gene: ENSMUSG00000024013

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144616
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of guanine nucleotide exchange factors (GEFs) which control cytoskeleton-dependent membrane rearrangements by activating the cell division cycle 42 (CDC42) protein. This gene is expressed in B lymphocytes, macrophages, and dendritic cells. The encoded protein may play a role in leukocyte signaling and vesicle trafficking in antigen-presenting cells in the immune system. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,656 S46G unknown Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam7 A T 14: 68,514,783 C417* probably null Het
Adgrl4 A C 3: 151,510,623 Q481P probably damaging Het
Adra2c C A 5: 35,280,698 N271K probably benign Het
Ahctf1 T C 1: 179,752,532 K2035R probably damaging Het
Ano3 T C 2: 110,794,960 T182A possibly damaging Het
Armc3 T C 2: 19,303,935 Y805H probably damaging Het
BC024139 TCCACCACCACCACCACCAC TCCACCACCACCACCAC 15: 76,120,193 probably benign Het
Cabp7 C T 11: 4,738,837 R211H probably damaging Het
Ccdc117 T C 11: 5,534,888 N112S possibly damaging Het
Cep120 C T 18: 53,740,125 D45N probably benign Het
Cpsf1 T C 15: 76,599,329 Y872C probably damaging Het
Cradd A G 10: 95,175,945 L111P probably damaging Het
Crhr2 A G 6: 55,102,830 L155P probably damaging Het
Fam46a T C 9: 85,324,740 D335G possibly damaging Het
Gm340 T A 19: 41,584,027 V407E probably benign Het
Gpam C T 19: 55,083,209 E367K probably damaging Het
Gtf3c1 T A 7: 125,643,954 N1826I probably damaging Het
Kcnq5 T C 1: 21,479,432 E357G probably damaging Het
Krt1 T A 15: 101,846,929 D465V probably damaging Het
Macrod1 T C 19: 7,196,792 V221A probably damaging Het
Mbd1 T C 18: 74,273,617 S144P possibly damaging Het
Mtfmt T C 9: 65,452,021 V326A probably benign Het
Myo1b T C 1: 51,863,358 D71G probably benign Het
Myo1h A G 5: 114,355,213 Y705C probably damaging Het
Nudt9 T C 5: 104,064,993 W311R probably damaging Het
Olfr132 A G 17: 38,131,009 F61S probably damaging Het
Olfr47 A T 6: 43,236,126 I173F probably damaging Het
Olfr743 C T 14: 50,533,781 A123V probably damaging Het
Olfr808 G A 10: 129,767,924 V143I probably benign Het
Osbp2 A T 11: 3,863,407 L154Q probably benign Het
P3h1 A G 4: 119,247,180 T633A probably damaging Het
Polq T G 16: 37,042,153 L616R probably damaging Het
Pon3 A G 6: 5,232,429 L197S possibly damaging Het
Rap1gds1 C T 3: 138,983,721 probably null Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rfng C A 11: 120,784,039 probably benign Het
Rps6ka2 T G 17: 7,300,322 L728R probably benign Het
Slc41a3 C A 6: 90,642,320 N360K possibly damaging Het
Sult1e1 T C 5: 87,578,538 N239S probably damaging Het
Tacr1 T A 6: 82,492,597 I154N probably damaging Het
Tacstd2 T A 6: 67,535,219 H163L probably benign Het
Tiam1 T C 16: 89,793,164 S1382G probably benign Het
Tmem43 A G 6: 91,479,929 E164G possibly damaging Het
U2af2 G A 7: 5,067,546 R78H probably benign Het
Yipf7 T A 5: 69,541,140 D8V possibly damaging Het
Zfp58 G A 13: 67,491,005 H456Y probably damaging Het
Zfp799 G A 17: 32,820,240 R351* probably null Het
Zfyve9 T C 4: 108,695,819 D715G probably damaging Het
Other mutations in Fgd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Fgd2 APN 17 29367975 missense probably damaging 1.00
IGL01505:Fgd2 APN 17 29366997 missense probably damaging 1.00
IGL03240:Fgd2 APN 17 29361161 splice site probably benign
ceci UTSW 17 29368376 splice site probably null
R0046:Fgd2 UTSW 17 29374990 splice site probably benign
R0271:Fgd2 UTSW 17 29367008 missense possibly damaging 0.94
R0594:Fgd2 UTSW 17 29365552 missense probably damaging 1.00
R0612:Fgd2 UTSW 17 29378347 missense probably benign 0.45
R1470:Fgd2 UTSW 17 29374108 splice site probably benign
R1551:Fgd2 UTSW 17 29378409 missense probably damaging 1.00
R1596:Fgd2 UTSW 17 29376930 missense probably benign 0.43
R1664:Fgd2 UTSW 17 29369299 missense probably damaging 1.00
R1689:Fgd2 UTSW 17 29363722 missense probably benign
R1691:Fgd2 UTSW 17 29378944 nonsense probably null
R1695:Fgd2 UTSW 17 29368245 missense possibly damaging 0.88
R3500:Fgd2 UTSW 17 29365601 missense possibly damaging 0.74
R3689:Fgd2 UTSW 17 29378950 missense probably benign 0.00
R4583:Fgd2 UTSW 17 29367078 missense possibly damaging 0.87
R4871:Fgd2 UTSW 17 29373249 missense possibly damaging 0.89
R5011:Fgd2 UTSW 17 29374980 critical splice donor site probably null
R5209:Fgd2 UTSW 17 29368376 splice site probably null
R7106:Fgd2 UTSW 17 29376970 nonsense probably null
R7139:Fgd2 UTSW 17 29373255 missense probably damaging 1.00
R7712:Fgd2 UTSW 17 29376912 missense probably benign 0.01
R7833:Fgd2 UTSW 17 29367395 missense possibly damaging 0.81
R7834:Fgd2 UTSW 17 29364951 missense probably damaging 1.00
R7913:Fgd2 UTSW 17 29374045 missense probably damaging 1.00
R8547:Fgd2 UTSW 17 29364960 missense probably damaging 0.99
R8686:Fgd2 UTSW 17 29379023 missense probably benign
R9088:Fgd2 UTSW 17 29364939 missense probably damaging 1.00
R9525:Fgd2 UTSW 17 29364981 missense probably damaging 1.00
Z1177:Fgd2 UTSW 17 29378326 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCCCATGTAAGAGGCTCATG -3'
(R):5'- TAGCCTGCAGTCCATAGCTC -3'

Sequencing Primer
(F):5'- TAGGTGGGGCCATGCAG -3'
(R):5'- CAGGTGGATTTCTAAATTCCAGGCC -3'
Posted On 2014-12-04