Incidental Mutation 'R2697:Macrod1'
ID251255
Institutional Source Beutler Lab
Gene Symbol Macrod1
Ensembl Gene ENSMUSG00000036278
Gene NameMACRO domain containing 1
Synonyms
MMRRC Submission 040435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2697 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7056768-7198061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7196792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 221 (V221A)
Ref Sequence ENSEMBL: ENSMUSP00000039507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025679] [ENSMUST00000040261] [ENSMUST00000123594] [ENSMUST00000142085]
Predicted Effect probably benign
Transcript: ENSMUST00000025679
SMART Domains Protein: ENSMUSP00000025679
Gene: ENSMUSG00000024767

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Peptidase_C65 40 271 1e-89 PFAM
Pfam:OTU 86 266 1.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040261
AA Change: V221A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039507
Gene: ENSMUSG00000036278
AA Change: V221A

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 25 41 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
A1pp 151 281 7.67e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123594
SMART Domains Protein: ENSMUSP00000115195
Gene: ENSMUSG00000024767

DomainStartEndE-ValueType
Pfam:Peptidase_C65 10 241 2e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127241
Predicted Effect probably benign
Transcript: ENSMUST00000142085
SMART Domains Protein: ENSMUSP00000122945
Gene: ENSMUSG00000024767

DomainStartEndE-ValueType
Pfam:Peptidase_C65 10 95 2.6e-30 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,656 S46G unknown Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam7 A T 14: 68,514,783 C417* probably null Het
Adgrl4 A C 3: 151,510,623 Q481P probably damaging Het
Adra2c C A 5: 35,280,698 N271K probably benign Het
Ahctf1 T C 1: 179,752,532 K2035R probably damaging Het
Ano3 T C 2: 110,794,960 T182A possibly damaging Het
Armc3 T C 2: 19,303,935 Y805H probably damaging Het
BC024139 TCCACCACCACCACCACCAC TCCACCACCACCACCAC 15: 76,120,193 probably benign Het
Cabp7 C T 11: 4,738,837 R211H probably damaging Het
Ccdc117 T C 11: 5,534,888 N112S possibly damaging Het
Cep120 C T 18: 53,740,125 D45N probably benign Het
Cpsf1 T C 15: 76,599,329 Y872C probably damaging Het
Cradd A G 10: 95,175,945 L111P probably damaging Het
Crhr2 A G 6: 55,102,830 L155P probably damaging Het
Fam46a T C 9: 85,324,740 D335G possibly damaging Het
Fgd2 A T 17: 29,376,921 T518S probably damaging Het
Gm340 T A 19: 41,584,027 V407E probably benign Het
Gpam C T 19: 55,083,209 E367K probably damaging Het
Gtf3c1 T A 7: 125,643,954 N1826I probably damaging Het
Kcnq5 T C 1: 21,479,432 E357G probably damaging Het
Krt1 T A 15: 101,846,929 D465V probably damaging Het
Mbd1 T C 18: 74,273,617 S144P possibly damaging Het
Mtfmt T C 9: 65,452,021 V326A probably benign Het
Myo1b T C 1: 51,863,358 D71G probably benign Het
Myo1h A G 5: 114,355,213 Y705C probably damaging Het
Nudt9 T C 5: 104,064,993 W311R probably damaging Het
Olfr132 A G 17: 38,131,009 F61S probably damaging Het
Olfr47 A T 6: 43,236,126 I173F probably damaging Het
Olfr743 C T 14: 50,533,781 A123V probably damaging Het
Olfr808 G A 10: 129,767,924 V143I probably benign Het
Osbp2 A T 11: 3,863,407 L154Q probably benign Het
P3h1 A G 4: 119,247,180 T633A probably damaging Het
Polq T G 16: 37,042,153 L616R probably damaging Het
Pon3 A G 6: 5,232,429 L197S possibly damaging Het
Rap1gds1 C T 3: 138,983,721 probably null Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rfng C A 11: 120,784,039 probably benign Het
Rps6ka2 T G 17: 7,300,322 L728R probably benign Het
Slc41a3 C A 6: 90,642,320 N360K possibly damaging Het
Sult1e1 T C 5: 87,578,538 N239S probably damaging Het
Tacr1 T A 6: 82,492,597 I154N probably damaging Het
Tacstd2 T A 6: 67,535,219 H163L probably benign Het
Tiam1 T C 16: 89,793,164 S1382G probably benign Het
Tmem43 A G 6: 91,479,929 E164G possibly damaging Het
U2af2 G A 7: 5,067,546 R78H probably benign Het
Yipf7 T A 5: 69,541,140 D8V possibly damaging Het
Zfp58 G A 13: 67,491,005 H456Y probably damaging Het
Zfp799 G A 17: 32,820,240 R351* probably null Het
Zfyve9 T C 4: 108,695,819 D715G probably damaging Het
Other mutations in Macrod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03280:Macrod1 APN 19 7197572 missense possibly damaging 0.93
R0138:Macrod1 UTSW 19 7196916 unclassified probably benign
R3085:Macrod1 UTSW 19 7196494 missense probably damaging 1.00
R6535:Macrod1 UTSW 19 7057147 missense probably damaging 1.00
R7688:Macrod1 UTSW 19 7196865 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGTTAAGTGTAAGGGCCTGG -3'
(R):5'- TGACATGGGGACTTGGTTAC -3'

Sequencing Primer
(F):5'- CTCTGACACTCAAGATAGCAGTTGG -3'
(R):5'- ACTTGGTGCCTTCCCTGATGAC -3'
Posted On2014-12-04