Mutagenetix > Incidental Mutation

Incidental Mutation 'R2698:Plcg1'

251280

Institutional Source

Beutler Lab

Gene Symbol

Plcg1

Ensembl Gene

ENSMUSG00000016933

Gene Name

phospholipase C, gamma 1

Synonyms

Cded, Plc-gamma1, Plcg-1, Plc-1

MMRRC Submission

040436-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2698 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

160731300-160775760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160761463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1185 (T1185A)

Ref Sequence

ENSEMBL: ENSMUSP00000105088 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590]

AlphaFold

Q62077

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000017077

Predicted Effect

probably benign
Transcript: ENSMUST00000103111

SMART Domains

Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
ZnF_C2H2	77	100	1.86e0	SMART
ZnF_C2H2	109	132	1.08e1	SMART
low complexity region	167	189	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
HOX	300	362	1.48e-6	SMART
low complexity region	434	447	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
HOX	489	551	2.25e-11	SMART
HOX	608	669	2.04e-9	SMART
low complexity region	677	690	N/A	INTRINSIC
HOX	759	821	7.49e-8	SMART
Pfam:Homez	836	888	5.2e-26	PFAM
low complexity region	919	936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103112

SMART Domains

Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
ZnF_C2H2	77	100	1.86e0	SMART
ZnF_C2H2	109	132	1.08e1	SMART
low complexity region	167	189	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
HOX	300	362	1.48e-6	SMART
low complexity region	434	447	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
HOX	489	551	2.25e-11	SMART
HOX	608	669	2.04e-9	SMART
low complexity region	677	690	N/A	INTRINSIC
HOX	759	821	7.49e-8	SMART
Pfam:Homez	836	888	5.2e-26	PFAM
low complexity region	919	936	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103115
AA Change: T1185A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: T1185A

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109462
AA Change: T1185A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: T1185A

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	240	318	5.2e-8	PFAM
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133937

Predicted Effect

unknown
Transcript: ENSMUST00000143997
AA Change: T96A

SMART Domains

Protein: ENSMUSP00000115181
Gene: ENSMUSG00000016933
AA Change: T96A

Domain	Start	End	E-Value	Type
C2	1	104	3.15e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147254

Predicted Effect

probably benign
Transcript: ENSMUST00000151590

SMART Domains

Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	239	318	4.4e-8	PFAM
PLCXc	320	464	3.7e-91	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173335

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173791

Meta Mutation Damage Score

0.0943

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	G	13: 66,433,434	S59P	probably damaging	Het
Abcc9	T	C	6: 142,633,136	R901G	possibly damaging	Het
Abhd18	T	A	3: 40,930,966	M262K	probably benign	Het
Ano2	C	A	6: 125,712,346	L145I	probably benign	Het
Ckap5	T	C	2: 91,578,081	W874R	probably damaging	Het
Cox4i1	G	T	8: 120,669,363		probably benign	Het
Cwc27	A	T	13: 104,806,751	N94K	probably damaging	Het
Dcaf11	T	C	14: 55,566,885	S372P	probably damaging	Het
Dpysl4	A	G	7: 139,096,765	N356S	probably damaging	Het
Dusp8	A	G	7: 142,081,964		probably benign	Het
Erc2	G	A	14: 28,271,705	V894M	probably benign	Het
Fbxo28	T	A	1: 182,317,154	I282F	probably benign	Het
Fsd2	T	C	7: 81,545,860	T434A	probably damaging	Het
Gabra4	T	C	5: 71,572,078	H453R	probably benign	Het
Glrx	T	A	13: 75,839,946		probably null	Het
Gm11541	A	T	11: 94,695,615	L102*	probably null	Het
Gm5113	T	A	7: 30,178,725	Y79*	probably null	Het
Gpr87	T	A	3: 59,179,166	N306I	probably damaging	Het
Hydin	T	A	8: 110,609,929	Y5113N	possibly damaging	Het
Iqsec3	C	T	6: 121,413,471		probably benign	Het
Kbtbd8	C	A	6: 95,126,589	Y406*	probably null	Het
Lamb1	G	T	12: 31,298,883	R590L	probably benign	Het
Lin54	A	T	5: 100,480,250	N31K	probably damaging	Het
Lnpk	T	C	2: 74,537,501	E165G	probably damaging	Het
Lrp4	C	T	2: 91,475,212	R276C	probably damaging	Het
Lrrc7	T	A	3: 158,135,391	T1384S	probably benign	Het
Mia2	T	C	12: 59,170,994		probably null	Het
Morc2a	T	C	11: 3,685,400	V797A	probably damaging	Het
Mrps23	T	C	11: 88,205,367		probably benign	Het
Muc3	A	T	5: 137,146,636	I62K	probably damaging	Het
Nlrp4g	T	A	9: 124,349,630		noncoding transcript	Het
Nptx1	A	T	11: 119,544,843		probably benign	Het
Olfr352	T	A	2: 36,870,196	I210K	possibly damaging	Het
Pabpc1l	T	G	2: 164,044,382		probably null	Het
Pdcd6ip	A	T	9: 113,674,507		probably null	Het
Plcxd1	A	G	5: 110,102,483	Q230R	probably benign	Het
Psme4	T	A	11: 30,874,282		probably null	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptch1	T	A	13: 63,542,224	N320Y	probably damaging	Het
Qars	G	A	9: 108,508,443	V60I	possibly damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rhag	T	C	17: 40,836,476	S410P	probably damaging	Het
Rnf213	A	G	11: 119,410,144	K297E	probably benign	Het
Rps6ka4	T	C	19: 6,837,352	E294G	probably benign	Het
Scaf4	T	A	16: 90,244,356	I695F	unknown	Het
Scrn2	T	C	11: 97,032,296		probably benign	Het
Scx	T	A	15: 76,458,163	C188S	probably damaging	Het
Sdk1	G	T	5: 142,212,050	V1893L	possibly damaging	Het
Sema5a	C	A	15: 32,673,400	Q795K	probably damaging	Het
Slc24a3	A	G	2: 145,613,567	S459G	probably benign	Het
Smurf1	A	G	5: 144,883,562		probably benign	Het
Taar4	T	C	10: 23,961,430	Y313H	probably damaging	Het
Tmprss11c	A	G	5: 86,271,463	F79S	probably damaging	Het
Tnfaip8l2	T	A	3: 95,140,361	I64F	possibly damaging	Het
Trbv13-1	A	G	6: 41,116,438	T102A	probably damaging	Het
Trpa1	A	T	1: 14,905,998	N160K	probably damaging	Het
Ttc22	A	G	4: 106,639,238	Y495C	probably benign	Het
Usp50	A	G	2: 126,778,029	I121T	probably damaging	Het
Vmn2r117	A	G	17: 23,459,911	S780P	probably damaging	Het
Vmn2r66	A	T	7: 84,995,399	V601D	probably damaging	Het
Wapl	G	A	14: 34,691,777	A199T	probably benign	Het
Zfp658	A	G	7: 43,573,545	T415A	possibly damaging	Het
Zfp760	C	T	17: 21,720,954	T9I	probably damaging	Het

Other mutations in Plcg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Plcg1	APN	2	160757266	missense	probably damaging	1.00
IGL00885:Plcg1	APN	2	160758083	missense	probably benign	0.03
IGL01066:Plcg1	APN	2	160754398	missense	probably damaging	1.00
IGL01356:Plcg1	APN	2	160753893	missense	probably damaging	1.00
IGL01629:Plcg1	APN	2	160758010	missense	possibly damaging	0.69
IGL01732:Plcg1	APN	2	160747779	missense	probably damaging	0.97
IGL01754:Plcg1	APN	2	160761433	missense	probably damaging	1.00
IGL02195:Plcg1	APN	2	160753926	missense	possibly damaging	0.83
IGL02371:Plcg1	APN	2	160753507	missense	probably damaging	0.99
IGL02671:Plcg1	APN	2	160755752	nonsense	probably null
IGL03096:Plcg1	APN	2	160757206	splice site	probably benign
IGL03129:Plcg1	APN	2	160774526	critical splice acceptor site	probably null
IGL03139:Plcg1	APN	2	160748129	critical splice donor site	probably null
IGL03211:Plcg1	APN	2	160759691	missense	possibly damaging	0.82
suscepit	UTSW	2	160753602	splice site	probably null
IGL03047:Plcg1	UTSW	2	160754879	missense	probably damaging	1.00
R0098:Plcg1	UTSW	2	160732000	missense	probably damaging	1.00
R0390:Plcg1	UTSW	2	160752366	missense	probably damaging	1.00
R0413:Plcg1	UTSW	2	160761429	missense	probably damaging	1.00
R0650:Plcg1	UTSW	2	160753363	splice site	probably benign
R0679:Plcg1	UTSW	2	160756910	missense	probably damaging	1.00
R0709:Plcg1	UTSW	2	160751778	splice site	probably null
R1719:Plcg1	UTSW	2	160753743	missense	probably null	0.94
R1721:Plcg1	UTSW	2	160731920	missense	probably damaging	0.99
R1727:Plcg1	UTSW	2	160748088	missense	probably benign	0.00
R1978:Plcg1	UTSW	2	160752578	splice site	probably null
R2277:Plcg1	UTSW	2	160755805	missense	possibly damaging	0.48
R3832:Plcg1	UTSW	2	160754437	missense	possibly damaging	0.95
R4094:Plcg1	UTSW	2	160747841	missense	probably damaging	0.98
R4260:Plcg1	UTSW	2	160751707	critical splice donor site	probably null
R4622:Plcg1	UTSW	2	160747768	splice site	probably benign
R4837:Plcg1	UTSW	2	160750986	missense	probably benign	0.00
R4942:Plcg1	UTSW	2	160753589	splice site	probably null
R5514:Plcg1	UTSW	2	160753355	critical splice donor site	probably null
R5647:Plcg1	UTSW	2	160751668	missense	probably benign	0.45
R5929:Plcg1	UTSW	2	160753602	splice site	probably null
R6303:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6304:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6471:Plcg1	UTSW	2	160753710	missense	probably benign	0.10
R6500:Plcg1	UTSW	2	160754567	missense	probably damaging	1.00
R7017:Plcg1	UTSW	2	160758097	missense	probably damaging	1.00
R7113:Plcg1	UTSW	2	160748283	missense	possibly damaging	0.78
R7137:Plcg1	UTSW	2	160753926	missense	possibly damaging	0.83
R7155:Plcg1	UTSW	2	160754380	missense	probably damaging	1.00
R7211:Plcg1	UTSW	2	160731874	missense	probably benign	0.02
R7777:Plcg1	UTSW	2	160754603	missense	possibly damaging	0.89
R7918:Plcg1	UTSW	2	160753665	missense	probably damaging	1.00
R7934:Plcg1	UTSW	2	160774578	missense	possibly damaging	0.53
R8309:Plcg1	UTSW	2	160753933	missense	probably benign	0.00
R8344:Plcg1	UTSW	2	160747896	missense	probably benign	0.00
R8377:Plcg1	UTSW	2	160754922	missense	probably damaging	1.00
R8524:Plcg1	UTSW	2	160761467	critical splice donor site	probably null
R8708:Plcg1	UTSW	2	160754553	splice site	probably benign
R8831:Plcg1	UTSW	2	160747812	missense	probably benign	0.02
R8936:Plcg1	UTSW	2	160748066	missense	probably benign	0.02
R9414:Plcg1	UTSW	2	160761356	missense	possibly damaging	0.80
R9466:Plcg1	UTSW	2	160754600	missense	probably benign
R9608:Plcg1	UTSW	2	160755751	missense	probably benign	0.02
R9755:Plcg1	UTSW	2	160731860	missense	probably benign	0.27
Z1176:Plcg1	UTSW	2	160758127	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTTGCTTTCACAGTGGAC -3'
(R):5'- GGGGCTATGACTGAACTCTCTG -3'

Sequencing Primer
(F):5'- CTTTCACAGTGGACAACGGACTG -3'
(R):5'- CCTTAGCAGGGAAAATGTCAATC -3'

Posted On

2014-12-04