Incidental Mutation 'R2507:Pcolce'
ID251314
Institutional Source Beutler Lab
Gene Symbol Pcolce
Ensembl Gene ENSMUSG00000029718
Gene Nameprocollagen C-endopeptidase enhancer protein
SynonymsAstt-2, Astt2
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137605103-137613784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137607051 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 260 (V260A)
Ref Sequence ENSEMBL: ENSMUSP00000031731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031731] [ENSMUST00000054564] [ENSMUST00000124693] [ENSMUST00000142675] [ENSMUST00000155251] [ENSMUST00000197912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031731
AA Change: V260A

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031731
Gene: ENSMUSG00000029718
AA Change: V260A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 158 272 3e-46 SMART
low complexity region 299 314 N/A INTRINSIC
low complexity region 323 338 N/A INTRINSIC
C345C 352 458 3.92e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000054564
AA Change: V285A

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057002
Gene: ENSMUSG00000029718
AA Change: V285A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 183 297 3e-46 SMART
low complexity region 324 339 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
C345C 377 483 3.92e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124693
SMART Domains Protein: ENSMUSP00000120749
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
Pfam:CUB 1 63 2.4e-12 PFAM
Pfam:CUB 76 124 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137210
Predicted Effect probably benign
Transcript: ENSMUST00000142675
SMART Domains Protein: ENSMUSP00000115654
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 18 130 3.79e-43 SMART
CUB 140 214 2.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148662
Predicted Effect probably benign
Transcript: ENSMUST00000155251
SMART Domains Protein: ENSMUSP00000121575
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 8 111 1.92e-21 SMART
Pfam:CUB 121 169 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197912
SMART Domains Protein: ENSMUSP00000142608
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 1 107 2.2e-36 SMART
C345C 130 236 1.3e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198801
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibrillar collagen types I-III are synthesized as precursor molecules known as procollagens. These precursors contain amino- and carboxyl-terminal peptide extensions known as N- and C-propeptides, respectively, which are cleaved, upon secretion of procollagen from the cell, to yield the mature triple helical, highly structured fibrils. This gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in thickened cortical and trabecular bone and abnormal collagen fibrils in both mineralized and nonmineralized tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Pcolce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Pcolce APN 5 137607476 missense probably damaging 0.98
IGL01566:Pcolce APN 5 137605160 utr 3 prime probably benign
R0157:Pcolce UTSW 5 137610479 unclassified probably null
R1585:Pcolce UTSW 5 137610507 nonsense probably null
R2307:Pcolce UTSW 5 137609094 missense probably damaging 0.99
R3700:Pcolce UTSW 5 137609047 missense probably damaging 0.98
R4011:Pcolce UTSW 5 137605774 missense probably benign 0.00
R4223:Pcolce UTSW 5 137605127 utr 3 prime probably benign
R4983:Pcolce UTSW 5 137605674 intron probably benign
R5141:Pcolce UTSW 5 137605750 missense probably benign 0.05
R5626:Pcolce UTSW 5 137610399 missense probably damaging 0.99
R6223:Pcolce UTSW 5 137605299 missense probably damaging 1.00
R6241:Pcolce UTSW 5 137605234 missense probably benign 0.00
R6643:Pcolce UTSW 5 137608903 missense probably damaging 0.97
R6938:Pcolce UTSW 5 137605616 missense probably benign 0.11
R7583:Pcolce UTSW 5 137607445 missense probably benign 0.01
R7596:Pcolce UTSW 5 137606825 critical splice donor site probably null
R7703:Pcolce UTSW 5 137605212 missense probably benign 0.00
R8012:Pcolce UTSW 5 137605195 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTCTCACACTTACCTGGGG -3'
(R):5'- TCTTCTGGAGTCTGCAGAGC -3'

Sequencing Primer
(F):5'- AAGCCTCTGGTGTCTCTGCAG -3'
(R):5'- CTGGAGTCTGCAGAGCTTGTG -3'
Posted On2014-12-04