Incidental Mutation 'R2698:Dusp8'
ID251331
Institutional Source Beutler Lab
Gene Symbol Dusp8
Ensembl Gene ENSMUSG00000037887
Gene Namedual specificity phosphatase 8
Synonyms5530400B01Rik, Nttp1
MMRRC Submission 040436-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R2698 (G1)
Quality Score88
Status Validated
Chromosome7
Chromosomal Location142079490-142095843 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 142081964 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039926] [ENSMUST00000143661]
Predicted Effect unknown
Transcript: ENSMUST00000039926
AA Change: F630L
SMART Domains Protein: ENSMUSP00000049414
Gene: ENSMUSG00000037887
AA Change: F630L

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
DSPc 160 299 3.6e-69 SMART
low complexity region 334 353 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 488 512 N/A INTRINSIC
low complexity region 546 600 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104221
Predicted Effect probably benign
Transcript: ENSMUST00000143661
SMART Domains Protein: ENSMUSP00000114307
Gene: ENSMUSG00000037887

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
Pfam:DSPc 168 231 1.5e-9 PFAM
Meta Mutation Damage Score 0.1235 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates SAPK/JNK and p38, is expressed predominantly in the adult brain, heart, and skeletal muscle, is localized in the cytoplasm, and is induced by nerve growth factor and insulin. An intronless pseudogene for DUSP8 is present on chromosome 10q11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myocardial fiber morphology, mildly increased cardiac muscle contractility at baseline, and decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,434 S59P probably damaging Het
Abcc9 T C 6: 142,633,136 R901G possibly damaging Het
Abhd18 T A 3: 40,930,966 M262K probably benign Het
Ano2 C A 6: 125,712,346 L145I probably benign Het
Ckap5 T C 2: 91,578,081 W874R probably damaging Het
Cox4i1 G T 8: 120,669,363 probably benign Het
Cwc27 A T 13: 104,806,751 N94K probably damaging Het
Dcaf11 T C 14: 55,566,885 S372P probably damaging Het
Dpysl4 A G 7: 139,096,765 N356S probably damaging Het
Erc2 G A 14: 28,271,705 V894M probably benign Het
Fbxo28 T A 1: 182,317,154 I282F probably benign Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gabra4 T C 5: 71,572,078 H453R probably benign Het
Glrx T A 13: 75,839,946 probably null Het
Gm11541 A T 11: 94,695,615 L102* probably null Het
Gm5113 T A 7: 30,178,725 Y79* probably null Het
Gpr87 T A 3: 59,179,166 N306I probably damaging Het
Hydin T A 8: 110,609,929 Y5113N possibly damaging Het
Iqsec3 C T 6: 121,413,471 probably benign Het
Kbtbd8 C A 6: 95,126,589 Y406* probably null Het
Lamb1 G T 12: 31,298,883 R590L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lnpk T C 2: 74,537,501 E165G probably damaging Het
Lrp4 C T 2: 91,475,212 R276C probably damaging Het
Lrrc7 T A 3: 158,135,391 T1384S probably benign Het
Mia2 T C 12: 59,170,994 probably null Het
Morc2a T C 11: 3,685,400 V797A probably damaging Het
Mrps23 T C 11: 88,205,367 probably benign Het
Muc3 A T 5: 137,146,636 I62K probably damaging Het
Nlrp4g T A 9: 124,349,630 noncoding transcript Het
Nptx1 A T 11: 119,544,843 probably benign Het
Olfr352 T A 2: 36,870,196 I210K possibly damaging Het
Pabpc1l T G 2: 164,044,382 probably null Het
Pdcd6ip A T 9: 113,674,507 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plcxd1 A G 5: 110,102,483 Q230R probably benign Het
Psme4 T A 11: 30,874,282 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptch1 T A 13: 63,542,224 N320Y probably damaging Het
Qars G A 9: 108,508,443 V60I possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rhag T C 17: 40,836,476 S410P probably damaging Het
Rnf213 A G 11: 119,410,144 K297E probably benign Het
Rps6ka4 T C 19: 6,837,352 E294G probably benign Het
Scaf4 T A 16: 90,244,356 I695F unknown Het
Scrn2 T C 11: 97,032,296 probably benign Het
Scx T A 15: 76,458,163 C188S probably damaging Het
Sdk1 G T 5: 142,212,050 V1893L possibly damaging Het
Sema5a C A 15: 32,673,400 Q795K probably damaging Het
Slc24a3 A G 2: 145,613,567 S459G probably benign Het
Smurf1 A G 5: 144,883,562 probably benign Het
Taar4 T C 10: 23,961,430 Y313H probably damaging Het
Tmprss11c A G 5: 86,271,463 F79S probably damaging Het
Tnfaip8l2 T A 3: 95,140,361 I64F possibly damaging Het
Trbv13-1 A G 6: 41,116,438 T102A probably damaging Het
Trpa1 A T 1: 14,905,998 N160K probably damaging Het
Ttc22 A G 4: 106,639,238 Y495C probably benign Het
Usp50 A G 2: 126,778,029 I121T probably damaging Het
Vmn2r117 A G 17: 23,459,911 S780P probably damaging Het
Vmn2r66 A T 7: 84,995,399 V601D probably damaging Het
Wapl G A 14: 34,691,777 A199T probably benign Het
Zfp658 A G 7: 43,573,545 T415A possibly damaging Het
Zfp760 C T 17: 21,720,954 T9I probably damaging Het
Other mutations in Dusp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Dusp8 APN 7 142084423 missense probably benign 0.05
IGL02458:Dusp8 APN 7 142082747 missense probably benign 0.28
IGL02931:Dusp8 APN 7 142082930 missense probably benign 0.00
IGL03329:Dusp8 APN 7 142084360 nonsense probably null
R0009:Dusp8 UTSW 7 142082054 unclassified probably benign
R1054:Dusp8 UTSW 7 142082067 unclassified probably benign
R1611:Dusp8 UTSW 7 142082957 missense probably benign 0.04
R1883:Dusp8 UTSW 7 142084348 splice site probably null
R2119:Dusp8 UTSW 7 142082561 missense possibly damaging 0.91
R2326:Dusp8 UTSW 7 142090063 missense probably damaging 1.00
R2905:Dusp8 UTSW 7 142083389 nonsense probably null
R3849:Dusp8 UTSW 7 142090065 missense probably damaging 1.00
R4921:Dusp8 UTSW 7 142082154 unclassified probably benign
R4942:Dusp8 UTSW 7 142082228 missense possibly damaging 0.85
R5288:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5385:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5386:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R6301:Dusp8 UTSW 7 142083019 unclassified probably null
R6520:Dusp8 UTSW 7 142083681 missense probably damaging 0.99
R6665:Dusp8 UTSW 7 142090105 missense probably damaging 0.97
RF016:Dusp8 UTSW 7 142082852 missense probably benign 0.04
X0064:Dusp8 UTSW 7 142082027 unclassified probably benign
Z1176:Dusp8 UTSW 7 142081943 missense unknown
Z1176:Dusp8 UTSW 7 142090077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGTTGCCAGATCACTAG -3'
(R):5'- CTGAACTTTGGAGACACGGC -3'

Sequencing Primer
(F):5'- GTAAAACCATTTACCTTTTCTGTGTG -3'
(R):5'- TGGACCCGGTAACAGCAG -3'
Posted On2014-12-04