Incidental Mutation 'R2698:Morc2a'
ID251347
Institutional Source Beutler Lab
Gene Symbol Morc2a
Ensembl Gene ENSMUSG00000034543
Gene Namemicrorchidia 2A
SynonymsZcwcc1, 8430403M08Rik
MMRRC Submission 040436-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2698 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3649494-3690477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3685400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 797 (V797A)
Ref Sequence ENSEMBL: ENSMUSP00000094176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093389] [ENSMUST00000096441]
Predicted Effect probably damaging
Transcript: ENSMUST00000093389
AA Change: V797A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091087
Gene: ENSMUSG00000034543
AA Change: V797A

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 495 542 5.1e-18 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096441
AA Change: V797A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094176
Gene: ENSMUSG00000034543
AA Change: V797A

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 494 543 1.7e-19 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131517
Meta Mutation Damage Score 0.2821 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The protein has been found to regulate the activity of ATP citrate lyase via specific interaction with this enzyme in the cytosol of lipogenic breast cancer cells. The protein also plays a role in lipogenesis and adipocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,434 S59P probably damaging Het
Abcc9 T C 6: 142,633,136 R901G possibly damaging Het
Abhd18 T A 3: 40,930,966 M262K probably benign Het
Ano2 C A 6: 125,712,346 L145I probably benign Het
Ckap5 T C 2: 91,578,081 W874R probably damaging Het
Cox4i1 G T 8: 120,669,363 probably benign Het
Cwc27 A T 13: 104,806,751 N94K probably damaging Het
Dcaf11 T C 14: 55,566,885 S372P probably damaging Het
Dpysl4 A G 7: 139,096,765 N356S probably damaging Het
Dusp8 A G 7: 142,081,964 probably benign Het
Erc2 G A 14: 28,271,705 V894M probably benign Het
Fbxo28 T A 1: 182,317,154 I282F probably benign Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gabra4 T C 5: 71,572,078 H453R probably benign Het
Glrx T A 13: 75,839,946 probably null Het
Gm11541 A T 11: 94,695,615 L102* probably null Het
Gm5113 T A 7: 30,178,725 Y79* probably null Het
Gpr87 T A 3: 59,179,166 N306I probably damaging Het
Hydin T A 8: 110,609,929 Y5113N possibly damaging Het
Iqsec3 C T 6: 121,413,471 probably benign Het
Kbtbd8 C A 6: 95,126,589 Y406* probably null Het
Lamb1 G T 12: 31,298,883 R590L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lnpk T C 2: 74,537,501 E165G probably damaging Het
Lrp4 C T 2: 91,475,212 R276C probably damaging Het
Lrrc7 T A 3: 158,135,391 T1384S probably benign Het
Mia2 T C 12: 59,170,994 probably null Het
Mrps23 T C 11: 88,205,367 probably benign Het
Muc3 A T 5: 137,146,636 I62K probably damaging Het
Nlrp4g T A 9: 124,349,630 noncoding transcript Het
Nptx1 A T 11: 119,544,843 probably benign Het
Olfr352 T A 2: 36,870,196 I210K possibly damaging Het
Pabpc1l T G 2: 164,044,382 probably null Het
Pdcd6ip A T 9: 113,674,507 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plcxd1 A G 5: 110,102,483 Q230R probably benign Het
Psme4 T A 11: 30,874,282 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptch1 T A 13: 63,542,224 N320Y probably damaging Het
Qars G A 9: 108,508,443 V60I possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rhag T C 17: 40,836,476 S410P probably damaging Het
Rnf213 A G 11: 119,410,144 K297E probably benign Het
Rps6ka4 T C 19: 6,837,352 E294G probably benign Het
Scaf4 T A 16: 90,244,356 I695F unknown Het
Scrn2 T C 11: 97,032,296 probably benign Het
Scx T A 15: 76,458,163 C188S probably damaging Het
Sdk1 G T 5: 142,212,050 V1893L possibly damaging Het
Sema5a C A 15: 32,673,400 Q795K probably damaging Het
Slc24a3 A G 2: 145,613,567 S459G probably benign Het
Smurf1 A G 5: 144,883,562 probably benign Het
Taar4 T C 10: 23,961,430 Y313H probably damaging Het
Tmprss11c A G 5: 86,271,463 F79S probably damaging Het
Tnfaip8l2 T A 3: 95,140,361 I64F possibly damaging Het
Trbv13-1 A G 6: 41,116,438 T102A probably damaging Het
Trpa1 A T 1: 14,905,998 N160K probably damaging Het
Ttc22 A G 4: 106,639,238 Y495C probably benign Het
Usp50 A G 2: 126,778,029 I121T probably damaging Het
Vmn2r117 A G 17: 23,459,911 S780P probably damaging Het
Vmn2r66 A T 7: 84,995,399 V601D probably damaging Het
Wapl G A 14: 34,691,777 A199T probably benign Het
Zfp658 A G 7: 43,573,545 T415A possibly damaging Het
Zfp760 C T 17: 21,720,954 T9I probably damaging Het
Other mutations in Morc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Morc2a APN 11 3680283 missense probably damaging 0.99
IGL00914:Morc2a APN 11 3668844 splice site probably null
IGL01081:Morc2a APN 11 3688149 missense probably damaging 1.00
IGL01092:Morc2a APN 11 3684042 missense probably benign 0.00
IGL01292:Morc2a APN 11 3688175 missense probably damaging 1.00
IGL01326:Morc2a APN 11 3681775 missense probably benign 0.03
IGL01526:Morc2a APN 11 3650428 missense probably benign 0.00
IGL01651:Morc2a APN 11 3658727 critical splice donor site probably null
IGL02860:Morc2a APN 11 3661821 splice site probably benign
IGL03372:Morc2a APN 11 3681813 splice site probably benign
R0136:Morc2a UTSW 11 3685907 intron probably null
R0267:Morc2a UTSW 11 3678567 missense probably benign 0.03
R0279:Morc2a UTSW 11 3683989 missense probably benign 0.09
R0556:Morc2a UTSW 11 3681809 critical splice donor site probably null
R1084:Morc2a UTSW 11 3650454 splice site probably benign
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1341:Morc2a UTSW 11 3680216 missense possibly damaging 0.80
R1460:Morc2a UTSW 11 3683794 missense probably benign 0.01
R1493:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1665:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1668:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1669:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1812:Morc2a UTSW 11 3685831 missense probably damaging 0.98
R2132:Morc2a UTSW 11 3679787 missense possibly damaging 0.89
R2133:Morc2a UTSW 11 3680302 nonsense probably null
R2200:Morc2a UTSW 11 3683919 missense probably benign 0.00
R3236:Morc2a UTSW 11 3683612 missense probably benign
R3698:Morc2a UTSW 11 3679672 nonsense probably null
R3743:Morc2a UTSW 11 3683700 missense possibly damaging 0.46
R4119:Morc2a UTSW 11 3683868 missense probably benign 0.00
R4898:Morc2a UTSW 11 3676664 nonsense probably null
R5148:Morc2a UTSW 11 3689084 missense probably damaging 1.00
R5228:Morc2a UTSW 11 3685439 missense probably damaging 0.96
R5395:Morc2a UTSW 11 3688232 missense possibly damaging 0.94
R5808:Morc2a UTSW 11 3683781 missense probably benign 0.00
R5942:Morc2a UTSW 11 3679936 missense probably damaging 1.00
R6634:Morc2a UTSW 11 3672376 critical splice donor site probably null
R7056:Morc2a UTSW 11 3675925 missense probably damaging 1.00
R7537:Morc2a UTSW 11 3683566 nonsense probably null
R8014:Morc2a UTSW 11 3677419 missense probably damaging 1.00
RF013:Morc2a UTSW 11 3676191 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCAAGTCATTCATCCTGTGCC -3'
(R):5'- GTCCTAGGATCCTAATAGGCTGC -3'

Sequencing Primer
(F):5'- TGTGCCTTGGCCCCATG -3'
(R):5'- TCCTAATAGGCTGCTAGGAGG -3'
Posted On2014-12-04