Mutagenetix > Incidental Mutation

Incidental Mutation 'R2698:Psme4'

251349

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

040436-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2698 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 30874282 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably null
Transcript: ENSMUST00000041231

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155719

Meta Mutation Damage Score

0.9582

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (63/63)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	G	13: 66,433,434	S59P	probably damaging	Het
Abcc9	T	C	6: 142,633,136	R901G	possibly damaging	Het
Abhd18	T	A	3: 40,930,966	M262K	probably benign	Het
Ano2	C	A	6: 125,712,346	L145I	probably benign	Het
Ckap5	T	C	2: 91,578,081	W874R	probably damaging	Het
Cox4i1	G	T	8: 120,669,363		probably benign	Het
Cwc27	A	T	13: 104,806,751	N94K	probably damaging	Het
Dcaf11	T	C	14: 55,566,885	S372P	probably damaging	Het
Dpysl4	A	G	7: 139,096,765	N356S	probably damaging	Het
Dusp8	A	G	7: 142,081,964		probably benign	Het
Erc2	G	A	14: 28,271,705	V894M	probably benign	Het
Fbxo28	T	A	1: 182,317,154	I282F	probably benign	Het
Fsd2	T	C	7: 81,545,860	T434A	probably damaging	Het
Gabra4	T	C	5: 71,572,078	H453R	probably benign	Het
Glrx	T	A	13: 75,839,946		probably null	Het
Gm11541	A	T	11: 94,695,615	L102*	probably null	Het
Gm5113	T	A	7: 30,178,725	Y79*	probably null	Het
Gpr87	T	A	3: 59,179,166	N306I	probably damaging	Het
Hydin	T	A	8: 110,609,929	Y5113N	possibly damaging	Het
Iqsec3	C	T	6: 121,413,471		probably benign	Het
Kbtbd8	C	A	6: 95,126,589	Y406*	probably null	Het
Lamb1	G	T	12: 31,298,883	R590L	probably benign	Het
Lin54	A	T	5: 100,480,250	N31K	probably damaging	Het
Lnpk	T	C	2: 74,537,501	E165G	probably damaging	Het
Lrp4	C	T	2: 91,475,212	R276C	probably damaging	Het
Lrrc7	T	A	3: 158,135,391	T1384S	probably benign	Het
Mia2	T	C	12: 59,170,994		probably null	Het
Morc2a	T	C	11: 3,685,400	V797A	probably damaging	Het
Mrps23	T	C	11: 88,205,367		probably benign	Het
Muc3	A	T	5: 137,146,636	I62K	probably damaging	Het
Nlrp4g	T	A	9: 124,349,630		noncoding transcript	Het
Nptx1	A	T	11: 119,544,843		probably benign	Het
Olfr352	T	A	2: 36,870,196	I210K	possibly damaging	Het
Pabpc1l	T	G	2: 164,044,382		probably null	Het
Pdcd6ip	A	T	9: 113,674,507		probably null	Het
Plcg1	A	G	2: 160,761,463	T1185A	possibly damaging	Het
Plcxd1	A	G	5: 110,102,483	Q230R	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptch1	T	A	13: 63,542,224	N320Y	probably damaging	Het
Qars	G	A	9: 108,508,443	V60I	possibly damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rhag	T	C	17: 40,836,476	S410P	probably damaging	Het
Rnf213	A	G	11: 119,410,144	K297E	probably benign	Het
Rps6ka4	T	C	19: 6,837,352	E294G	probably benign	Het
Scaf4	T	A	16: 90,244,356	I695F	unknown	Het
Scrn2	T	C	11: 97,032,296		probably benign	Het
Scx	T	A	15: 76,458,163	C188S	probably damaging	Het
Sdk1	G	T	5: 142,212,050	V1893L	possibly damaging	Het
Sema5a	C	A	15: 32,673,400	Q795K	probably damaging	Het
Slc24a3	A	G	2: 145,613,567	S459G	probably benign	Het
Smurf1	A	G	5: 144,883,562		probably benign	Het
Taar4	T	C	10: 23,961,430	Y313H	probably damaging	Het
Tmprss11c	A	G	5: 86,271,463	F79S	probably damaging	Het
Tnfaip8l2	T	A	3: 95,140,361	I64F	possibly damaging	Het
Trbv13-1	A	G	6: 41,116,438	T102A	probably damaging	Het
Trpa1	A	T	1: 14,905,998	N160K	probably damaging	Het
Ttc22	A	G	4: 106,639,238	Y495C	probably benign	Het
Usp50	A	G	2: 126,778,029	I121T	probably damaging	Het
Vmn2r117	A	G	17: 23,459,911	S780P	probably damaging	Het
Vmn2r66	A	T	7: 84,995,399	V601D	probably damaging	Het
Wapl	G	A	14: 34,691,777	A199T	probably benign	Het
Zfp658	A	G	7: 43,573,545	T415A	possibly damaging	Het
Zfp760	C	T	17: 21,720,954	T9I	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGTCCCCACTCAGCTTTC -3'
(R):5'- AGTTGCAGTAGTAGACAGGTTTC -3'

Sequencing Primer
(F):5'- AAGTGATTATTCCTCCAGGTTCGAG -3'
(R):5'- CAGTAGTAGACAGGTTTCTTTGTAC -3'

Posted On

2014-12-04