Incidental Mutation 'R2507:Dopey1'
ID251360
Institutional Source Beutler Lab
Gene Symbol Dopey1
Ensembl Gene ENSMUSG00000034973
Gene Namedopey family member 1
SynonymsB130005I07Rik, D9Ertd809e
MMRRC Submission 040413-MU
Accession Numbers

Genbank: NM_177208; MGI: 1289294

Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location86467154-86555923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86513117 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 759 (F759Y)
Ref Sequence ENSEMBL: ENSMUSP00000140740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000188675] [ENSMUST00000190957]
Predicted Effect probably damaging
Transcript: ENSMUST00000034987
AA Change: F759Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: F759Y

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185919
AA Change: F757Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: F757Y

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186418
Predicted Effect probably benign
Transcript: ENSMUST00000188675
SMART Domains Protein: ENSMUSP00000139413
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 3e-106 PFAM
low complexity region 622 640 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190957
AA Change: F759Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: F759Y

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Dopey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dopey1 APN 9 86551679 missense possibly damaging 0.57
IGL00427:Dopey1 APN 9 86521500 missense probably benign 0.09
IGL00427:Dopey1 APN 9 86521498 missense possibly damaging 0.93
IGL00427:Dopey1 APN 9 86521499 missense probably damaging 0.96
IGL00577:Dopey1 APN 9 86520946 missense probably damaging 1.00
IGL00741:Dopey1 APN 9 86522806 missense possibly damaging 0.50
IGL00959:Dopey1 APN 9 86487431 missense probably damaging 1.00
IGL01339:Dopey1 APN 9 86551677 missense possibly damaging 0.90
IGL01608:Dopey1 APN 9 86507561 missense probably benign 0.23
IGL01760:Dopey1 APN 9 86519923 missense probably benign
IGL01788:Dopey1 APN 9 86531719 missense probably benign 0.03
IGL01844:Dopey1 APN 9 86514085 missense probably damaging 1.00
IGL01923:Dopey1 APN 9 86522867 missense probably damaging 1.00
IGL02036:Dopey1 APN 9 86531765 missense probably benign 0.18
IGL02308:Dopey1 APN 9 86520088 missense probably damaging 0.98
IGL02494:Dopey1 APN 9 86526818 missense probably damaging 1.00
IGL02698:Dopey1 APN 9 86524359 splice site probably benign
IGL02731:Dopey1 APN 9 86487381 missense probably damaging 1.00
IGL02821:Dopey1 APN 9 86520156 missense probably benign
IGL02952:Dopey1 APN 9 86532922 splice site probably benign
IGL03071:Dopey1 APN 9 86489615 missense possibly damaging 0.91
IGL03271:Dopey1 APN 9 86504222 nonsense probably null
IGL03344:Dopey1 APN 9 86536144 missense probably damaging 1.00
Beg UTSW 9 86548172 nonsense probably null
groak UTSW 9 86521657 missense probably damaging 1.00
R0055:Dopey1 UTSW 9 86512652 missense probably benign 0.08
R0285:Dopey1 UTSW 9 86512639 missense probably damaging 1.00
R0415:Dopey1 UTSW 9 86506502 missense probably damaging 1.00
R0427:Dopey1 UTSW 9 86507532 missense probably damaging 1.00
R0514:Dopey1 UTSW 9 86520734 missense probably damaging 1.00
R0538:Dopey1 UTSW 9 86485497 missense probably damaging 1.00
R1118:Dopey1 UTSW 9 86515406 missense probably damaging 1.00
R1158:Dopey1 UTSW 9 86485556 missense probably damaging 1.00
R1272:Dopey1 UTSW 9 86521424 missense probably damaging 1.00
R1448:Dopey1 UTSW 9 86542732 splice site probably null
R1584:Dopey1 UTSW 9 86548172 nonsense probably null
R1601:Dopey1 UTSW 9 86536250 missense probably damaging 0.99
R1674:Dopey1 UTSW 9 86536160 missense probably damaging 0.98
R1706:Dopey1 UTSW 9 86554080 missense possibly damaging 0.92
R1856:Dopey1 UTSW 9 86492004 missense probably damaging 0.99
R1926:Dopey1 UTSW 9 86523019 missense probably damaging 1.00
R1929:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2029:Dopey1 UTSW 9 86521365 missense probably damaging 1.00
R2125:Dopey1 UTSW 9 86521046 missense probably damaging 1.00
R2206:Dopey1 UTSW 9 86521599 missense probably benign 0.00
R2271:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2312:Dopey1 UTSW 9 86521442 nonsense probably null
R2379:Dopey1 UTSW 9 86521085 missense probably damaging 1.00
R3737:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R3804:Dopey1 UTSW 9 86520995 missense probably damaging 1.00
R3916:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R3921:Dopey1 UTSW 9 86520271 missense probably benign 0.06
R4035:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R4392:Dopey1 UTSW 9 86503143 intron probably benign
R4404:Dopey1 UTSW 9 86522813 nonsense probably null
R4513:Dopey1 UTSW 9 86520559 missense probably benign 0.39
R4624:Dopey1 UTSW 9 86521525 missense probably damaging 1.00
R4659:Dopey1 UTSW 9 86502032 intron probably benign
R4910:Dopey1 UTSW 9 86492061 missense probably damaging 1.00
R4919:Dopey1 UTSW 9 86520056 missense possibly damaging 0.47
R5061:Dopey1 UTSW 9 86503108 splice site probably benign
R5079:Dopey1 UTSW 9 86487421 missense probably damaging 1.00
R5118:Dopey1 UTSW 9 86506259 missense probably damaging 1.00
R5169:Dopey1 UTSW 9 86533021 missense probably damaging 1.00
R5176:Dopey1 UTSW 9 86521815 missense probably damaging 1.00
R5190:Dopey1 UTSW 9 86487304 missense probably damaging 1.00
R5256:Dopey1 UTSW 9 86515328 missense probably damaging 1.00
R5346:Dopey1 UTSW 9 86520782 missense probably damaging 1.00
R5484:Dopey1 UTSW 9 86545288 missense probably damaging 1.00
R5501:Dopey1 UTSW 9 86507730 missense probably benign 0.04
R5554:Dopey1 UTSW 9 86521657 missense probably damaging 1.00
R5707:Dopey1 UTSW 9 86502997 missense possibly damaging 0.95
R5826:Dopey1 UTSW 9 86507570 missense possibly damaging 0.94
R5921:Dopey1 UTSW 9 86501922 missense probably damaging 1.00
R5934:Dopey1 UTSW 9 86542442 nonsense probably null
R5936:Dopey1 UTSW 9 86536512 nonsense probably null
R6046:Dopey1 UTSW 9 86515343 missense probably damaging 1.00
R6053:Dopey1 UTSW 9 86515294 missense possibly damaging 0.95
R6072:Dopey1 UTSW 9 86507697 missense probably benign 0.00
R6104:Dopey1 UTSW 9 86520807 missense possibly damaging 0.86
R6125:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R6299:Dopey1 UTSW 9 86504212 missense probably damaging 1.00
R6930:Dopey1 UTSW 9 86531772 critical splice donor site probably null
R6949:Dopey1 UTSW 9 86500860 missense probably damaging 1.00
R6979:Dopey1 UTSW 9 86521642 missense possibly damaging 0.77
R7035:Dopey1 UTSW 9 86524302 missense possibly damaging 0.85
R7069:Dopey1 UTSW 9 86550169 critical splice donor site probably null
R7101:Dopey1 UTSW 9 86507669 missense probably benign
R7202:Dopey1 UTSW 9 86504167 splice site probably null
R7222:Dopey1 UTSW 9 86522876 critical splice donor site probably null
R7233:Dopey1 UTSW 9 86521696 missense probably benign 0.00
R7236:Dopey1 UTSW 9 86515378 missense probably damaging 1.00
R7252:Dopey1 UTSW 9 86500821 missense probably damaging 1.00
R7268:Dopey1 UTSW 9 86512777 nonsense probably null
R7353:Dopey1 UTSW 9 86512859 missense probably damaging 0.99
R7481:Dopey1 UTSW 9 86535932 missense probably damaging 1.00
R7498:Dopey1 UTSW 9 86494411 missense possibly damaging 0.95
R7507:Dopey1 UTSW 9 86535949 missense probably benign 0.01
R7525:Dopey1 UTSW 9 86506290 missense probably damaging 1.00
R7539:Dopey1 UTSW 9 86521573 missense probably benign 0.03
R7751:Dopey1 UTSW 9 86507730 missense probably benign 0.00
R7753:Dopey1 UTSW 9 86489702 missense possibly damaging 0.52
R7839:Dopey1 UTSW 9 86542765 nonsense probably null
R7868:Dopey1 UTSW 9 86501984 critical splice donor site probably null
R7922:Dopey1 UTSW 9 86542765 nonsense probably null
R7951:Dopey1 UTSW 9 86501984 critical splice donor site probably null
R8061:Dopey1 UTSW 9 86521193 missense possibly damaging 0.95
R8067:Dopey1 UTSW 9 86518339 missense probably benign 0.00
R8156:Dopey1 UTSW 9 86494457 missense probably damaging 1.00
RF004:Dopey1 UTSW 9 86554191 missense probably benign
X0019:Dopey1 UTSW 9 86506227 missense probably damaging 1.00
X0019:Dopey1 UTSW 9 86531750 missense probably damaging 0.98
ZE80:Dopey1 UTSW 9 86500842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGGCTGCAGATCATCAG -3'
(R):5'- GTAATCCCATAACAGCAACTCTATG -3'

Sequencing Primer
(F):5'- CTGCAGATCATCAGGGAGACTTC -3'
(R):5'- TATGACCACTTCATCAGGCTGGAG -3'
Posted On2014-12-04