Mutagenetix > Incidental Mutation

Incidental Mutation 'R2507:Med23'

251366

Institutional Source

Beutler Lab

Gene Symbol

Med23

Ensembl Gene

ENSMUSG00000019984

Gene Name

mediator complex subunit 23

Synonyms

X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2

MMRRC Submission

040413-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2507 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24869986-24913681 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24910813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 939 (D939G)

Ref Sequence

ENSEMBL: ENSMUSP00000135232 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000020161] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000020159
AA Change: D1299G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: D1299G

Domain	Start	End	E-Value	Type
Pfam:Med23	3	1310	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000020161

SMART Domains

Protein: ENSMUSP00000020161
Gene: ENSMUSG00000019987

Domain	Start	End	E-Value	Type
Pfam:Arginase	6	305	1.4e-79	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000092646
AA Change: D1305G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: D1305G

Domain	Start	End	E-Value	Type
Pfam:Med23	4	1316	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176285
AA Change: D939G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: D939G

Domain	Start	End	E-Value	Type
Pfam:Med23	1	51	4.4e-14	PFAM
Pfam:Med23	48	950	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177232

SMART Domains

Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

Domain	Start	End	E-Value	Type
Pfam:Med23	3	58	1.2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184228

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218260

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	A	G	10: 21,621,782		probably benign	Het
4930535I16Rik	G	A	4: 123,917,947		probably benign	Het
Akr1b3	C	T	6: 34,310,064	E186K	probably damaging	Het
Apc	A	T	18: 34,316,537	N2128I	possibly damaging	Het
Api5	T	C	2: 94,429,817	I31M	probably damaging	Het
Armcx4	T	G	X: 134,695,379	V2012G	possibly damaging	Het
Aurka	T	C	2: 172,370,445	E4G	probably benign	Het
B4galt5	T	A	2: 167,306,638	M187L	probably benign	Het
Bsn	T	C	9: 108,116,114	D813G	probably damaging	Het
Bub1	A	T	2: 127,801,423	D1000E	probably benign	Het
C87499	T	A	4: 88,629,211	K161N	possibly damaging	Het
Cacna1f	T	G	X: 7,626,448		probably null	Het
Cdh6	A	G	15: 13,041,361	I539T	probably benign	Het
Cdhr3	T	C	12: 33,038,915	D756G	probably benign	Het
Cenph	A	T	13: 100,771,236	D85E	probably benign	Het
Chd9	C	T	8: 91,033,987	P2120L	probably benign	Het
Clec2h	A	G	6: 128,673,982	N75S	probably benign	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cox4i1	T	A	8: 120,673,290	V51E	possibly damaging	Het
Cpne3	A	T	4: 19,553,871	N53K	probably damaging	Het
Cpt1b	A	G	15: 89,419,098	F585L	probably benign	Het
Daam1	G	A	12: 71,975,223	D732N	probably damaging	Het
Dner	A	T	1: 84,583,080	C115S	probably damaging	Het
Dopey1	T	A	9: 86,513,117	F759Y	probably damaging	Het
Dst	T	C	1: 34,011,909	Y29H	probably damaging	Het
Dst	T	C	1: 34,188,417	V1875A	possibly damaging	Het
Duox1	A	G	2: 122,333,138	D817G	probably benign	Het
Emc2	A	T	15: 43,511,698		probably null	Het
Erich3	A	T	3: 154,698,659	E51V	probably null	Het
Exoc2	A	G	13: 30,882,365	Y443H	possibly damaging	Het
Fbf1	T	C	11: 116,155,426	R200G	probably benign	Het
Fdxr	G	A	11: 115,271,980	T100I	probably damaging	Het
Galnt11	C	G	5: 25,247,612	P41A	probably damaging	Het
Galnt4	A	G	10: 99,109,286	K291R	possibly damaging	Het
Gm12695	T	A	4: 96,754,189	E301V	probably damaging	Het
Gopc	C	T	10: 52,353,326		probably null	Het
Gria1	A	T	11: 57,289,320	T699S	probably null	Het
Gsr	T	G	8: 33,680,288	D200E	probably benign	Het
Ikzf2	G	A	1: 69,539,288	A282V	probably benign	Het
Irak2	T	C	6: 113,647,678	I45T	probably damaging	Het
Irx1	T	C	13: 71,959,820	K248E	probably damaging	Het
Kcns3	A	C	12: 11,092,086	V204G	possibly damaging	Het
Lmo1	C	A	7: 109,140,641	M91I	probably damaging	Het
Map3k21	A	G	8: 125,939,938	D623G	possibly damaging	Het
Map4	A	G	9: 110,037,483		probably benign	Het
Mark3	T	A	12: 111,627,242	V236E	probably damaging	Het
Mrgpra9	A	G	7: 47,235,494	C142R	possibly damaging	Het
N4bp2	T	A	5: 65,790,061	D11E	probably benign	Het
Ntng2	T	C	2: 29,207,519	N310S	probably damaging	Het
Olfr1328	T	C	4: 118,933,925	M308V	probably benign	Het
Olfr1414	A	G	1: 92,511,378	S217P	probably damaging	Het
Pcolce	A	G	5: 137,607,051	V260A	possibly damaging	Het
Pds5b	C	A	5: 150,756,428	T533K	possibly damaging	Het
Pecr	A	G	1: 72,261,976	Y268H	probably benign	Het
Phax	T	A	18: 56,586,884	F299Y	probably damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Prpf39	T	A	12: 65,057,815	F551L	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ralgapa1	G	A	12: 55,718,201	P889S	probably damaging	Het
Rpap1	A	G	2: 119,780,054		probably null	Het
Rufy3	T	C	5: 88,649,898	S645P	probably damaging	Het
Samd1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	8: 83,998,996		probably benign	Het
Spata7	G	T	12: 98,658,450	A172S	probably benign	Het
Stk35	A	G	2: 129,801,515	T140A	probably damaging	Het
Thop1	T	G	10: 81,070,264	M1R	probably null	Het
Tlr1	T	C	5: 64,925,296	Y646C	probably damaging	Het
Tpp2	A	G	1: 44,001,449	Y290C	probably benign	Het
Tpr	A	G	1: 150,392,944	M1V	probably null	Het
Trim6	T	C	7: 104,228,185	F161L	probably damaging	Het
Ubash3b	T	C	9: 41,157,354	K25E	possibly damaging	Het
Unc45b	G	A	11: 82,940,137		probably null	Het
Unc80	A	G	1: 66,612,107	N1537S	possibly damaging	Het
Usb1	T	C	8: 95,343,124	F100S	probably damaging	Het
Vmn1r17	C	A	6: 57,361,259	L40F	probably damaging	Het
Vmn1r233	A	T	17: 20,993,848	M280K	probably benign	Het
Zfp37	A	T	4: 62,191,256	C524S	probably damaging	Het
Zfp426	T	C	9: 20,470,431	K420R	probably benign	Het

Other mutations in Med23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00670:Med23	APN	10	24888584	missense	probably damaging	1.00
IGL00792:Med23	APN	10	24877004	missense	possibly damaging	0.93
IGL01289:Med23	APN	10	24902121	missense	probably damaging	1.00
IGL01469:Med23	APN	10	24882597	missense	probably damaging	1.00
IGL01598:Med23	APN	10	24903798	missense	probably benign	0.34
IGL02324:Med23	APN	10	24897341	missense	probably damaging	0.98
IGL02381:Med23	APN	10	24900728	missense	possibly damaging	0.95
IGL02465:Med23	APN	10	24903743	missense	probably damaging	0.96
IGL02554:Med23	APN	10	24898575	critical splice donor site	probably null
IGL02683:Med23	APN	10	24870717	missense	probably benign	0.00
PIT4362001:Med23	UTSW	10	24874571	missense	probably benign	0.01
R0080:Med23	UTSW	10	24912817	missense	probably benign	0.33
R0125:Med23	UTSW	10	24900788	missense	probably damaging	1.00
R0311:Med23	UTSW	10	24897358	missense	possibly damaging	0.95
R0765:Med23	UTSW	10	24900710	missense	probably damaging	1.00
R1302:Med23	UTSW	10	24888422	splice site	probably null
R1456:Med23	UTSW	10	24903652	splice site	probably benign
R1514:Med23	UTSW	10	24892667	splice site	probably benign
R1774:Med23	UTSW	10	24903686	missense	probably damaging	1.00
R1851:Med23	UTSW	10	24910870	splice site	probably null
R1928:Med23	UTSW	10	24909812	missense	probably benign
R1975:Med23	UTSW	10	24910766	missense	probably benign	0.01
R2011:Med23	UTSW	10	24879755	missense	possibly damaging	0.63
R2266:Med23	UTSW	10	24874601	missense	probably benign	0.00
R2309:Med23	UTSW	10	24870688	missense	probably damaging	0.99
R2566:Med23	UTSW	10	24888575	missense	probably damaging	1.00
R3720:Med23	UTSW	10	24891120	missense	probably damaging	1.00
R3771:Med23	UTSW	10	24902201	missense	probably damaging	1.00
R3811:Med23	UTSW	10	24892592	nonsense	probably null
R3811:Med23	UTSW	10	24892593	splice site	probably null
R4305:Med23	UTSW	10	24904270	nonsense	probably null
R4323:Med23	UTSW	10	24870705	missense	probably benign	0.02
R4701:Med23	UTSW	10	24893648	missense	probably damaging	1.00
R4886:Med23	UTSW	10	24874683	critical splice donor site	probably null
R4925:Med23	UTSW	10	24910747	missense	probably damaging	1.00
R4943:Med23	UTSW	10	24875669	missense	possibly damaging	0.92
R5207:Med23	UTSW	10	24895836	nonsense	probably null
R5749:Med23	UTSW	10	24888449	missense	possibly damaging	0.84
R5806:Med23	UTSW	10	24907221	missense	probably damaging	1.00
R5896:Med23	UTSW	10	24902145	missense	probably damaging	1.00
R5954:Med23	UTSW	10	24870483	splice site	probably benign
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6093:Med23	UTSW	10	24878443	missense	probably benign	0.16
R6107:Med23	UTSW	10	24906034	nonsense	probably null
R6356:Med23	UTSW	10	24888413	missense	probably damaging	0.98
R6393:Med23	UTSW	10	24873476	missense	possibly damaging	0.91
R6533:Med23	UTSW	10	24893620	missense	probably damaging	1.00
R6911:Med23	UTSW	10	24902181	missense	probably damaging	0.98
R6981:Med23	UTSW	10	24895824	missense	possibly damaging	0.92
R7085:Med23	UTSW	10	24870121	missense	probably damaging	1.00
R7215:Med23	UTSW	10	24888429	missense	probably benign
R7229:Med23	UTSW	10	24902004	missense	probably benign
R7489:Med23	UTSW	10	24904356	missense	probably damaging	1.00
R7530:Med23	UTSW	10	24905953	missense	probably benign	0.00
R7643:Med23	UTSW	10	24905965	missense	probably benign	0.01
R7653:Med23	UTSW	10	24904384	missense	probably damaging	1.00
R7764:Med23	UTSW	10	24909920	critical splice donor site	probably null
R7784:Med23	UTSW	10	24902448	missense	probably damaging	1.00
R8024:Med23	UTSW	10	24879683	missense	possibly damaging	0.74
R8182:Med23	UTSW	10	24912807	missense	probably benign
R8412:Med23	UTSW	10	24908734	missense	probably benign	0.01
R8874:Med23	UTSW	10	24895719	missense	possibly damaging	0.92
R8975:Med23	UTSW	10	24904436	missense	probably benign	0.42
R9131:Med23	UTSW	10	24904381	missense
R9202:Med23	UTSW	10	24904304	missense	probably benign	0.12
R9341:Med23	UTSW	10	24912807	missense	probably benign
R9342:Med23	UTSW	10	24874571	missense	probably benign	0.01
R9343:Med23	UTSW	10	24912807	missense	probably benign
R9412:Med23	UTSW	10	24902121	missense	probably damaging	1.00
RF003:Med23	UTSW	10	24903785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTCCCTCTGCACAAGTG -3'
(R):5'- ATCTAGAATTATGTTCTCCTGTGGCC -3'

Sequencing Primer
(F):5'- AAGTGCCATCCCGTGTCAGTG -3'
(R):5'- CCTGTGGCCTTAAGAGGTTAGATAC -3'

Posted On

2014-12-04