Incidental Mutation 'R0309:Chaf1b'
ID25137
Institutional Source Beutler Lab
Gene Symbol Chaf1b
Ensembl Gene ENSMUSG00000022945
Gene Namechromatin assembly factor 1, subunit B (p60)
Synonyms2600017H24Rik, CAF1P60, CAF1A, MPHOSPH7, CAF1, CAF-I 60 kDa subunit, CAF-IP60, CAF-1 subunit B
MMRRC Submission 038519-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R0309 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location93883901-93906115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93884511 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 6 (C6S)
Ref Sequence ENSEMBL: ENSMUSP00000121034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023666] [ENSMUST00000117099] [ENSMUST00000120586] [ENSMUST00000142316]
Predicted Effect probably damaging
Transcript: ENSMUST00000023666
AA Change: C6S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023666
Gene: ENSMUSG00000022945
AA Change: C6S

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 564 2e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117099
AA Change: C6S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113684
Gene: ENSMUSG00000022945
AA Change: C6S

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 561 6.3e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120586
AA Change: C6S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113420
Gene: ENSMUSG00000022945
AA Change: C6S

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124313
Predicted Effect probably damaging
Transcript: ENSMUST00000142316
AA Change: C6S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121034
Gene: ENSMUSG00000022945
AA Change: C6S

DomainStartEndE-ValueType
Pfam:WD40 8 45 3.5e-4 PFAM
Blast:WD40 55 79 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232065
Meta Mutation Damage Score 0.3934 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF-I) is required for the assembly of histone octamers onto newly-replicated DNA. CAF-I is composed of three protein subunits, p50, p60, and p150. The protein encoded by this gene corresponds to the p60 subunit and is required for chromatin assembly after replication. The encoded protein is differentially phosphorylated in a cell cycle-dependent manner. In addition, it is normally found in the nucleus except during mitosis, when it is released into the cytoplasm. This protein is a member of the WD-repeat HIR1 family and may also be involved in DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,259 D133G possibly damaging Het
Abcb4 A C 5: 8,939,835 D796A probably damaging Het
Actg2 A T 6: 83,519,914 V147E probably damaging Het
Adamts13 A C 2: 26,986,989 T534P probably damaging Het
Ago1 T C 4: 126,443,166 T249A probably benign Het
Ahnak T A 19: 9,002,495 I381N probably damaging Het
Akap9 A G 5: 4,069,038 D3515G probably benign Het
Angptl3 T C 4: 99,034,469 V249A probably benign Het
Ank A G 15: 27,567,572 T294A possibly damaging Het
Ank1 A T 8: 23,104,809 H204L probably damaging Het
Apbb2 A G 5: 66,310,988 probably benign Het
Arhgap28 A T 17: 67,901,429 S15T probably benign Het
Aspm T C 1: 139,482,511 probably benign Het
Atp1a4 T C 1: 172,234,987 E651G probably damaging Het
B3gnt2 A T 11: 22,836,860 F109L probably damaging Het
Bpifb4 T C 2: 153,959,683 F575L probably damaging Het
Calr C A 8: 84,843,031 K322N probably benign Het
Ccdc188 T C 16: 18,219,305 S247P possibly damaging Het
Cdr1 T A X: 61,185,302 D86V unknown Het
Cep97 C T 16: 55,925,058 V48I probably damaging Het
Chd3 C T 11: 69,357,018 D920N probably damaging Het
Clk1 T C 1: 58,413,033 probably benign Het
Cntnap3 T A 13: 64,757,436 probably benign Het
Col12a1 T A 9: 79,600,011 probably null Het
Col17a1 G T 19: 47,671,362 probably benign Het
Coq7 T A 7: 118,529,717 I32F possibly damaging Het
Cox6a2 A T 7: 128,205,935 F59I probably damaging Het
Cpq A G 15: 33,594,151 D436G probably damaging Het
Ctso G A 3: 81,944,861 probably null Het
Cxadr A T 16: 78,334,948 H274L probably benign Het
Cyp2c40 A T 19: 39,778,051 C367S possibly damaging Het
Cyp2c70 T G 19: 40,160,671 M344L possibly damaging Het
Defa35 G A 8: 21,065,855 V77I probably benign Het
Dhx57 A G 17: 80,274,881 Y432H probably damaging Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah7a C G 1: 53,405,690 D3952H probably damaging Het
Dnah9 C A 11: 66,026,972 probably benign Het
Dstyk C A 1: 132,456,864 probably benign Het
Efcab2 T A 1: 178,475,904 probably benign Het
Ehbp1l1 T C 19: 5,720,570 E287G possibly damaging Het
Epgn A G 5: 91,032,214 T87A probably benign Het
Erc2 A C 14: 28,141,225 E803A probably damaging Het
Fam26d A G 10: 34,044,047 W75R probably damaging Het
Fer A G 17: 64,139,016 *454W probably null Het
Glyr1 T C 16: 5,031,972 D179G probably damaging Het
Gm12830 T A 4: 114,844,976 probably benign Het
Gm14085 A T 2: 122,517,553 T253S probably benign Het
Gm9922 C A 14: 101,729,693 probably benign Het
Gsta3 C T 1: 21,264,894 P200S possibly damaging Het
Hmgxb3 G A 18: 61,155,128 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il16 T C 7: 83,722,554 K15E probably damaging Het
Kcnip2 T A 19: 45,794,075 probably benign Het
Kdm4c T C 4: 74,345,567 V696A probably benign Het
Kdr A G 5: 75,946,927 probably benign Het
Klhl33 T G 14: 50,891,411 H787P probably damaging Het
Klk14 A T 7: 43,694,345 T159S probably benign Het
Lancl2 A G 6: 57,703,132 N16D probably damaging Het
Lemd3 T C 10: 120,937,110 N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,271,015 probably null Het
Mpl T G 4: 118,446,038 probably benign Het
Myh7b T C 2: 155,630,672 probably benign Het
Mylk A C 16: 34,912,297 probably benign Het
Myof A T 19: 37,981,266 M316K probably benign Het
Nfib T A 4: 82,296,737 N543I probably damaging Het
Nfix A G 8: 84,721,774 S375P probably damaging Het
Nkrf T C X: 36,890,116 Q171R probably damaging Het
Nmnat2 T A 1: 153,077,001 probably benign Het
Npffr2 G A 5: 89,583,347 E379K probably benign Het
Npr2 T C 4: 43,640,904 probably benign Het
Nup98 A C 7: 102,152,428 D212E probably null Het
Nwd2 T C 5: 63,807,218 Y1382H probably damaging Het
Ocstamp T C 2: 165,395,992 R451G possibly damaging Het
Olfr593 T A 7: 103,212,721 I287K probably damaging Het
Olfr804 A G 10: 129,705,139 D87G probably benign Het
Pabpc1 C T 15: 36,597,493 A551T possibly damaging Het
Papd7 A T 13: 69,499,932 V781E possibly damaging Het
Pard3 A T 8: 127,376,897 probably benign Het
Pcdhb12 G T 18: 37,436,121 V107L probably benign Het
Pik3cd A T 4: 149,663,220 V22D probably damaging Het
Pkd1l2 A G 8: 116,997,576 V2396A probably damaging Het
Pnpla7 T C 2: 24,987,195 I167T probably damaging Het
Pphln1 A T 15: 93,441,707 H114L possibly damaging Het
Ppm1h A G 10: 122,920,782 N444S probably damaging Het
Prdm9 G A 17: 15,557,384 T146I probably damaging Het
Prrc2a A G 17: 35,150,915 probably benign Het
Prrx1 T C 1: 163,312,559 D26G possibly damaging Het
Ptpn5 T C 7: 47,079,294 E495G probably damaging Het
Rab23 A C 1: 33,734,861 probably null Het
Ralgps1 C T 2: 33,157,923 M348I probably benign Het
Ranbp2 A G 10: 58,479,868 T2137A probably benign Het
Rapgef4 G T 2: 72,226,030 G654V probably benign Het
Rc3h2 A T 2: 37,379,008 probably benign Het
Reg2 G A 6: 78,406,186 A39T possibly damaging Het
Sema4d C A 13: 51,725,311 V7F probably benign Het
Sgip1 T C 4: 102,915,157 probably benign Het
Sgpl1 C T 10: 61,113,437 probably null Het
Shisa9 G A 16: 11,997,123 V212M probably damaging Het
Shq1 G A 6: 100,573,627 P450L probably benign Het
Sin3a A G 9: 57,110,912 T872A probably benign Het
Sipa1l3 C T 7: 29,348,350 R1371Q probably benign Het
Skint8 T C 4: 111,938,867 V246A probably benign Het
Slc22a20 A T 19: 5,972,957 V386D probably damaging Het
Slc2a7 G A 4: 150,158,071 probably benign Het
Slc35a2 T A X: 7,889,662 Y48N probably damaging Het
Slc4a2 G T 5: 24,434,346 S413I probably damaging Het
Sntg2 T C 12: 30,226,773 T427A probably benign Het
Soat1 T C 1: 156,442,453 Y132C probably damaging Het
Stn1 G T 19: 47,501,673 H342N probably benign Het
Tarbp1 T A 8: 126,438,928 probably benign Het
Tas2r113 A C 6: 132,893,378 K123T probably damaging Het
Tbck C T 3: 132,734,407 Q504* probably null Het
Tenm3 C T 8: 48,341,034 C380Y probably damaging Het
Triobp A G 15: 78,976,540 D1389G probably damaging Het
Trpm4 A T 7: 45,308,706 F780I probably damaging Het
Tubb4a G T 17: 57,081,182 Y281* probably null Het
Txndc15 T C 13: 55,724,582 F261S probably damaging Het
Ube3b T C 5: 114,419,469 probably benign Het
Unc5c G C 3: 141,733,933 V196L probably benign Het
Upf3a G A 8: 13,795,500 probably null Het
Vmn2r20 T C 6: 123,386,104 K574E probably benign Het
Vps50 A G 6: 3,536,853 M275V possibly damaging Het
Xrcc5 A G 1: 72,307,576 probably benign Het
Zbtb18 T C 1: 177,448,616 L505S probably damaging Het
Zbtb41 T C 1: 139,438,984 I567T probably damaging Het
Zfp598 T C 17: 24,678,584 probably benign Het
Other mutations in Chaf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Chaf1b APN 16 93900191 unclassified probably benign
R0090:Chaf1b UTSW 16 93887124 missense possibly damaging 0.52
R0690:Chaf1b UTSW 16 93900017 splice site probably benign
R1494:Chaf1b UTSW 16 93888110 missense probably damaging 1.00
R1572:Chaf1b UTSW 16 93901230 missense possibly damaging 0.77
R1595:Chaf1b UTSW 16 93905099 critical splice donor site probably null
R1654:Chaf1b UTSW 16 93894903 missense probably damaging 0.97
R2057:Chaf1b UTSW 16 93894907 missense probably damaging 1.00
R2280:Chaf1b UTSW 16 93891571 missense probably damaging 1.00
R2406:Chaf1b UTSW 16 93900155 missense probably damaging 0.99
R2655:Chaf1b UTSW 16 93891511 missense probably damaging 0.99
R4522:Chaf1b UTSW 16 93901295 missense probably benign 0.05
R4605:Chaf1b UTSW 16 93888089 missense possibly damaging 0.90
R4686:Chaf1b UTSW 16 93884584 missense probably benign 0.00
R4784:Chaf1b UTSW 16 93884542 missense probably damaging 1.00
R4862:Chaf1b UTSW 16 93887134 missense probably damaging 0.99
R5603:Chaf1b UTSW 16 93892795 missense probably damaging 1.00
R5683:Chaf1b UTSW 16 93887142 missense possibly damaging 0.90
R6763:Chaf1b UTSW 16 93891505 missense probably damaging 1.00
R6940:Chaf1b UTSW 16 93905965 missense probably benign 0.00
R7401:Chaf1b UTSW 16 93884380 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TAGGTTTGCTGATACCCGGCTTCC -3'
(R):5'- TAGTACACTGGACTAGGTGGCAACCC -3'

Sequencing Primer
(F):5'- AACACGATGCTCTGTGCTG -3'
(R):5'- GCTGCCTTCAGTTTTAAACAAAG -3'
Posted On2013-04-16