Incidental Mutation 'R2507:Gria1'
ID251376
Institutional Source Beutler Lab
Gene Symbol Gria1
Ensembl Gene ENSMUSG00000020524
Gene Nameglutamate receptor, ionotropic, AMPA1 (alpha 1)
SynonymsGlr1, Glur-1, GluRA, HIPA1, GluR1, GluR-A, 2900051M01Rik, Glur1, GluA1, Glr-1
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location57011387-57330244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57289320 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 699 (T699S)
Ref Sequence ENSEMBL: ENSMUSP00000091731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036315] [ENSMUST00000094179] [ENSMUST00000151045]
Predicted Effect probably null
Transcript: ENSMUST00000036315
AA Change: T699S

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044494
Gene: ENSMUSG00000020524
AA Change: T699S

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 9.3e-63 PFAM
PBPe 408 783 3.65e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000094179
AA Change: T699S

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091731
Gene: ENSMUSG00000020524
AA Change: T699S

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 3.7e-69 PFAM
PBPe 408 783 2.09e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151045
AA Change: T630S

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117746
Gene: ENSMUSG00000020524
AA Change: T630S

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 303 4.7e-58 PFAM
PBPe 339 714 3.65e-121 SMART
Lig_chan-Glu_bd 349 414 1.65e-29 SMART
transmembrane domain 739 761 N/A INTRINSIC
low complexity region 794 805 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. This gene belongs to a family of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations in phosphorylation sites have LTD and LTP deficits and spatial learning memory defects. Null homozygotes also show stimulus-reward learning deficits and increases locomotor activity and context-dependent sensitization to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Gria1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Gria1 APN 11 57242941 nonsense probably null
IGL00807:Gria1 APN 11 57012040 missense probably benign
IGL00816:Gria1 APN 11 57317742 missense possibly damaging 0.93
IGL01110:Gria1 APN 11 57289381 missense probably damaging 1.00
IGL01116:Gria1 APN 11 57236975 missense probably damaging 1.00
IGL01120:Gria1 APN 11 57317669 missense probably damaging 0.99
IGL01843:Gria1 APN 11 57317774 missense probably damaging 1.00
IGL02135:Gria1 APN 11 57185853 missense probably damaging 1.00
IGL02308:Gria1 APN 11 57236924 missense probably benign 0.00
IGL02554:Gria1 APN 11 57289488 missense possibly damaging 0.72
IGL02813:Gria1 APN 11 57283584 missense probably damaging 1.00
IGL03071:Gria1 APN 11 57012110 unclassified probably null
IGL03326:Gria1 APN 11 57317773 missense probably damaging 1.00
PIT4445001:Gria1 UTSW 11 57185838 missense probably damaging 1.00
R0087:Gria1 UTSW 11 57317712 missense probably damaging 1.00
R0387:Gria1 UTSW 11 57309884 critical splice donor site probably null
R0399:Gria1 UTSW 11 57186027 missense probably damaging 0.97
R0502:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0503:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0549:Gria1 UTSW 11 57228973 missense probably damaging 1.00
R0590:Gria1 UTSW 11 57289409 missense probably damaging 1.00
R1377:Gria1 UTSW 11 57201176 missense probably damaging 1.00
R1395:Gria1 UTSW 11 57283566 missense probably damaging 1.00
R1422:Gria1 UTSW 11 57189788 missense probably benign 0.00
R1581:Gria1 UTSW 11 57237010 splice site probably null
R2002:Gria1 UTSW 11 57012104 missense possibly damaging 0.93
R2064:Gria1 UTSW 11 57317708 missense probably damaging 0.98
R2255:Gria1 UTSW 11 57185949 missense probably damaging 1.00
R2965:Gria1 UTSW 11 57185801 nonsense probably null
R3012:Gria1 UTSW 11 57289434 missense probably damaging 1.00
R3151:Gria1 UTSW 11 57283562 missense probably damaging 1.00
R3807:Gria1 UTSW 11 57310678 missense probably damaging 1.00
R5026:Gria1 UTSW 11 57310696 missense probably damaging 1.00
R5132:Gria1 UTSW 11 57289399 missense probably damaging 1.00
R5222:Gria1 UTSW 11 57189797 missense probably benign 0.22
R5303:Gria1 UTSW 11 57243025 missense probably benign 0.01
R5332:Gria1 UTSW 11 57327621 missense possibly damaging 0.93
R5413:Gria1 UTSW 11 57217794 missense probably benign 0.00
R5748:Gria1 UTSW 11 57309876 missense probably benign 0.00
R5878:Gria1 UTSW 11 57317802 critical splice donor site probably null
R5937:Gria1 UTSW 11 57189733 missense probably benign 0.00
R5995:Gria1 UTSW 11 57289285 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6180:Gria1 UTSW 11 57242792 missense probably damaging 1.00
R6187:Gria1 UTSW 11 57238110 missense possibly damaging 0.84
R6262:Gria1 UTSW 11 57242854 missense probably damaging 1.00
R6828:Gria1 UTSW 11 57289462 missense probably damaging 1.00
R7374:Gria1 UTSW 11 57189808 missense probably benign
R7507:Gria1 UTSW 11 57228939 missense probably benign 0.14
R7511:Gria1 UTSW 11 57283625 missense probably damaging 1.00
R7691:Gria1 UTSW 11 57236987 missense possibly damaging 0.94
R7898:Gria1 UTSW 11 57242765 missense probably damaging 1.00
R7981:Gria1 UTSW 11 57242765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCAAGCTCCACTCAGC -3'
(R):5'- AAATGCAGCAGCTTCGGTCC -3'

Sequencing Primer
(F):5'- AGCTCTTCCCTGATGCGTGTG -3'
(R):5'- GAAGCAGATCTGGGTACTTACCTC -3'
Posted On2014-12-04