Incidental Mutation 'R2507:Kcns3'
ID251382
Institutional Source Beutler Lab
Gene Symbol Kcns3
Ensembl Gene ENSMUSG00000043673
Gene Namepotassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
SynonymsD12Ertd137e
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location11090202-11151056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 11092086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 204 (V204G)
Ref Sequence ENSEMBL: ENSMUSP00000152026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055673] [ENSMUST00000164495] [ENSMUST00000217974]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055673
AA Change: V204G

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060706
Gene: ENSMUSG00000043673
AA Change: V204G

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164495
AA Change: V204G

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129412
Gene: ENSMUSG00000043673
AA Change: V204G

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217974
AA Change: V204G

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Kcns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Kcns3 APN 12 11092426 missense probably benign 0.40
IGL01089:Kcns3 APN 12 11091571 missense possibly damaging 0.92
IGL01448:Kcns3 APN 12 11091643 missense possibly damaging 0.91
IGL02084:Kcns3 APN 12 11092194 missense probably damaging 0.96
IGL02229:Kcns3 APN 12 11092092 missense probably damaging 1.00
IGL02730:Kcns3 APN 12 11092075 missense probably benign
IGL02820:Kcns3 APN 12 11091871 missense probably benign 0.01
IGL03390:Kcns3 APN 12 11091232 missense probably benign
PIT4696001:Kcns3 UTSW 12 11092748 start gained probably benign
R0583:Kcns3 UTSW 12 11091478 missense probably damaging 1.00
R0629:Kcns3 UTSW 12 11092558 missense probably damaging 1.00
R1549:Kcns3 UTSW 12 11092083 missense probably damaging 1.00
R1571:Kcns3 UTSW 12 11091550 missense probably damaging 1.00
R1755:Kcns3 UTSW 12 11091444 missense probably benign 0.09
R4348:Kcns3 UTSW 12 11091381 missense possibly damaging 0.85
R4667:Kcns3 UTSW 12 11091783 missense probably damaging 1.00
R4750:Kcns3 UTSW 12 11091654 missense probably damaging 1.00
R5704:Kcns3 UTSW 12 11092327 missense probably benign 0.05
R5770:Kcns3 UTSW 12 11092249 missense probably benign 0.15
R6882:Kcns3 UTSW 12 11092048 missense probably benign 0.00
R7014:Kcns3 UTSW 12 11091687 missense probably damaging 1.00
R8025:Kcns3 UTSW 12 11091845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCACCTTGCCCATATTC -3'
(R):5'- TGAGCACAGACTCCTCCTTTG -3'

Sequencing Primer
(F):5'- TTGGTGTCCACAGCCAAC -3'
(R):5'- AGACTCCTCCTTTGAAGAATCG -3'
Posted On2014-12-04