Incidental Mutation 'R2698:Scaf4'
ID251391
Institutional Source Beutler Lab
Gene Symbol Scaf4
Ensembl Gene ENSMUSG00000022983
Gene NameSR-related CTD-associated factor 4
SynonymsSfrs15, Sra4, Srsf15
MMRRC Submission 040436-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R2698 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90225680-90284503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90244356 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 695 (I695F)
Ref Sequence ENSEMBL: ENSMUSP00000156174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039280] [ENSMUST00000163419] [ENSMUST00000232371]
Predicted Effect unknown
Transcript: ENSMUST00000039280
AA Change: I698F
SMART Domains Protein: ENSMUSP00000044472
Gene: ENSMUSG00000022983
AA Change: I698F

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 558 N/A INTRINSIC
RRM 574 643 7.47e-14 SMART
low complexity region 719 757 N/A INTRINSIC
low complexity region 762 829 N/A INTRINSIC
low complexity region 871 886 N/A INTRINSIC
low complexity region 937 980 N/A INTRINSIC
low complexity region 983 997 N/A INTRINSIC
low complexity region 1006 1046 N/A INTRINSIC
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1111 1145 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163419
AA Change: I694F
SMART Domains Protein: ENSMUSP00000132250
Gene: ENSMUSG00000022983
AA Change: I694F

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 554 N/A INTRINSIC
RRM 570 639 7.47e-14 SMART
low complexity region 715 753 N/A INTRINSIC
low complexity region 758 825 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 911 954 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1056 1070 N/A INTRINSIC
low complexity region 1085 1119 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231594
Predicted Effect unknown
Transcript: ENSMUST00000232371
AA Change: I695F
Meta Mutation Damage Score 0.0879 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the arginine/serine-rich splicing factor family. A similar protein in Rat appears to bind the large subunit of RNA polymerase II and provide a link between transcription and pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,434 S59P probably damaging Het
Abcc9 T C 6: 142,633,136 R901G possibly damaging Het
Abhd18 T A 3: 40,930,966 M262K probably benign Het
Ano2 C A 6: 125,712,346 L145I probably benign Het
Ckap5 T C 2: 91,578,081 W874R probably damaging Het
Cox4i1 G T 8: 120,669,363 probably benign Het
Cwc27 A T 13: 104,806,751 N94K probably damaging Het
Dcaf11 T C 14: 55,566,885 S372P probably damaging Het
Dpysl4 A G 7: 139,096,765 N356S probably damaging Het
Dusp8 A G 7: 142,081,964 probably benign Het
Erc2 G A 14: 28,271,705 V894M probably benign Het
Fbxo28 T A 1: 182,317,154 I282F probably benign Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gabra4 T C 5: 71,572,078 H453R probably benign Het
Glrx T A 13: 75,839,946 probably null Het
Gm11541 A T 11: 94,695,615 L102* probably null Het
Gm5113 T A 7: 30,178,725 Y79* probably null Het
Gpr87 T A 3: 59,179,166 N306I probably damaging Het
Hydin T A 8: 110,609,929 Y5113N possibly damaging Het
Iqsec3 C T 6: 121,413,471 probably benign Het
Kbtbd8 C A 6: 95,126,589 Y406* probably null Het
Lamb1 G T 12: 31,298,883 R590L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lnpk T C 2: 74,537,501 E165G probably damaging Het
Lrp4 C T 2: 91,475,212 R276C probably damaging Het
Lrrc7 T A 3: 158,135,391 T1384S probably benign Het
Mia2 T C 12: 59,170,994 probably null Het
Morc2a T C 11: 3,685,400 V797A probably damaging Het
Mrps23 T C 11: 88,205,367 probably benign Het
Muc3 A T 5: 137,146,636 I62K probably damaging Het
Nlrp4g T A 9: 124,349,630 noncoding transcript Het
Nptx1 A T 11: 119,544,843 probably benign Het
Olfr352 T A 2: 36,870,196 I210K possibly damaging Het
Pabpc1l T G 2: 164,044,382 probably null Het
Pdcd6ip A T 9: 113,674,507 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plcxd1 A G 5: 110,102,483 Q230R probably benign Het
Psme4 T A 11: 30,874,282 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptch1 T A 13: 63,542,224 N320Y probably damaging Het
Qars G A 9: 108,508,443 V60I possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rhag T C 17: 40,836,476 S410P probably damaging Het
Rnf213 A G 11: 119,410,144 K297E probably benign Het
Rps6ka4 T C 19: 6,837,352 E294G probably benign Het
Scrn2 T C 11: 97,032,296 probably benign Het
Scx T A 15: 76,458,163 C188S probably damaging Het
Sdk1 G T 5: 142,212,050 V1893L possibly damaging Het
Sema5a C A 15: 32,673,400 Q795K probably damaging Het
Slc24a3 A G 2: 145,613,567 S459G probably benign Het
Smurf1 A G 5: 144,883,562 probably benign Het
Taar4 T C 10: 23,961,430 Y313H probably damaging Het
Tmprss11c A G 5: 86,271,463 F79S probably damaging Het
Tnfaip8l2 T A 3: 95,140,361 I64F possibly damaging Het
Trbv13-1 A G 6: 41,116,438 T102A probably damaging Het
Trpa1 A T 1: 14,905,998 N160K probably damaging Het
Ttc22 A G 4: 106,639,238 Y495C probably benign Het
Usp50 A G 2: 126,778,029 I121T probably damaging Het
Vmn2r117 A G 17: 23,459,911 S780P probably damaging Het
Vmn2r66 A T 7: 84,995,399 V601D probably damaging Het
Wapl G A 14: 34,691,777 A199T probably benign Het
Zfp658 A G 7: 43,573,545 T415A possibly damaging Het
Zfp760 C T 17: 21,720,954 T9I probably damaging Het
Other mutations in Scaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Scaf4 APN 16 90247281 missense unknown
IGL00536:Scaf4 APN 16 90257362 missense unknown
IGL01122:Scaf4 APN 16 90248630 missense unknown
IGL02015:Scaf4 APN 16 90258846 missense unknown
IGL02074:Scaf4 APN 16 90242920 missense unknown
IGL02555:Scaf4 APN 16 90250305 missense unknown
IGL02735:Scaf4 APN 16 90245515 missense unknown
FR4304:Scaf4 UTSW 16 90229854 small deletion probably benign
FR4589:Scaf4 UTSW 16 90229854 small deletion probably benign
R0217:Scaf4 UTSW 16 90242682 missense probably damaging 0.99
R0410:Scaf4 UTSW 16 90260170 missense unknown
R0681:Scaf4 UTSW 16 90249694 missense unknown
R1099:Scaf4 UTSW 16 90263098 missense unknown
R1510:Scaf4 UTSW 16 90245394 missense unknown
R1694:Scaf4 UTSW 16 90229857 small deletion probably benign
R2077:Scaf4 UTSW 16 90252435 missense unknown
R2087:Scaf4 UTSW 16 90252425 missense unknown
R2182:Scaf4 UTSW 16 90230140 missense probably benign 0.15
R2925:Scaf4 UTSW 16 90250289 missense unknown
R3025:Scaf4 UTSW 16 90251938 missense unknown
R3236:Scaf4 UTSW 16 90260217 missense unknown
R4207:Scaf4 UTSW 16 90260215 missense unknown
R4584:Scaf4 UTSW 16 90229515 unclassified probably benign
R4735:Scaf4 UTSW 16 90252432 missense unknown
R4835:Scaf4 UTSW 16 90250307 missense unknown
R4969:Scaf4 UTSW 16 90251943 nonsense probably null
R5174:Scaf4 UTSW 16 90247174 missense unknown
R5568:Scaf4 UTSW 16 90229857 small deletion probably benign
R5615:Scaf4 UTSW 16 90251960 missense unknown
R5638:Scaf4 UTSW 16 90244310 missense unknown
R6364:Scaf4 UTSW 16 90260248 nonsense probably null
R6470:Scaf4 UTSW 16 90229638 nonsense probably null
R7049:Scaf4 UTSW 16 90260187 missense unknown
R7198:Scaf4 UTSW 16 90252430 missense unknown
R7446:Scaf4 UTSW 16 90258770 missense unknown
R7501:Scaf4 UTSW 16 90230076 missense unknown
R7580:Scaf4 UTSW 16 90229852 nonsense probably null
R7631:Scaf4 UTSW 16 90229557 missense unknown
X0013:Scaf4 UTSW 16 90252291 missense unknown
Predicted Primers PCR Primer
(F):5'- GATTTCATAAGTAGGCCTTCAGACC -3'
(R):5'- TTAGAGCTGAGAATGTCACCC -3'

Sequencing Primer
(F):5'- CCTTTGAAGGGTTAAACCATGCTC -3'
(R):5'- GCTGAGAATGTCACCCATATTTCTG -3'
Posted On2014-12-04