Incidental Mutation 'R2507:Cdh6'
ID251403
Institutional Source Beutler Lab
Gene Symbol Cdh6
Ensembl Gene ENSMUSG00000039385
Gene Namecadherin 6
Synonymscad6, K-cadherin
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location13028701-13173675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13041361 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 539 (I539T)
Ref Sequence ENSEMBL: ENSMUSP00000037113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036439]
PDB Structure Crystal structure of cadherin-6 EC12 W4A [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000036439
AA Change: I539T

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037113
Gene: ENSMUSG00000039385
AA Change: I539T

DomainStartEndE-ValueType
CA 76 157 7e-15 SMART
CA 181 266 9.06e-32 SMART
CA 290 382 1.14e-19 SMART
CA 405 486 8.81e-21 SMART
CA 509 596 2.82e-10 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 5.6e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit delay in mesenchyme-to-epithelial conversion and a loss of nephrons. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed mesenchyme to epithelial conversion and loss of nephrons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Cdh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Cdh6 APN 15 13034359 nonsense probably null
IGL00675:Cdh6 APN 15 13041439 missense possibly damaging 0.80
IGL01063:Cdh6 APN 15 13064495 missense probably damaging 1.00
IGL01335:Cdh6 APN 15 13051309 missense probably benign 0.40
IGL01351:Cdh6 APN 15 13034240 missense possibly damaging 0.55
IGL02010:Cdh6 APN 15 13034190 utr 3 prime probably benign
IGL02428:Cdh6 APN 15 13064430 missense possibly damaging 0.94
PIT4651001:Cdh6 UTSW 15 13044719 missense possibly damaging 0.69
R0124:Cdh6 UTSW 15 13034324 missense probably damaging 1.00
R0256:Cdh6 UTSW 15 13053782 splice site probably benign
R0696:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R1017:Cdh6 UTSW 15 13051476 missense probably benign 0.06
R1240:Cdh6 UTSW 15 13057455 missense possibly damaging 0.48
R1444:Cdh6 UTSW 15 13091838 missense probably benign 0.00
R2008:Cdh6 UTSW 15 13051476 missense possibly damaging 0.74
R2050:Cdh6 UTSW 15 13057501 missense probably benign
R3082:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3083:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3903:Cdh6 UTSW 15 13042575 missense probably benign 0.39
R4591:Cdh6 UTSW 15 13051486 missense possibly damaging 0.69
R4859:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R4898:Cdh6 UTSW 15 13034688 missense probably damaging 0.99
R5242:Cdh6 UTSW 15 13064411 missense probably benign 0.05
R5313:Cdh6 UTSW 15 13034637 missense probably damaging 1.00
R5545:Cdh6 UTSW 15 13041149 missense probably damaging 1.00
R6360:Cdh6 UTSW 15 13041460 missense possibly damaging 0.82
R6650:Cdh6 UTSW 15 13051401 missense probably benign 0.11
R6830:Cdh6 UTSW 15 13044774 missense probably benign 0.01
R7369:Cdh6 UTSW 15 13042638 missense probably damaging 0.99
R7506:Cdh6 UTSW 15 13034310 missense probably damaging 1.00
R8121:Cdh6 UTSW 15 13044671 missense probably damaging 1.00
R8801:Cdh6 UTSW 15 13044761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCGAAATGACCACAGG -3'
(R):5'- CTGTGAGAACCACTTTCGGG -3'

Sequencing Primer
(F):5'- CAGGAGATAGGTGCTCATCTC -3'
(R):5'- GCCCTGAGCCTTTGTGACAG -3'
Posted On2014-12-04