Incidental Mutation 'R2844:Rngtt'
ID251416
Institutional Source Beutler Lab
Gene Symbol Rngtt
Ensembl Gene ENSMUSG00000028274
Gene NameRNA guanylyltransferase and 5'-phosphatase
Synonymsmouse capping enzyme
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R2844 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location33310311-33502614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33368678 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 404 (T404A)
Ref Sequence ENSEMBL: ENSMUSP00000103788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029942] [ENSMUST00000108153]
PDB Structure
CRYSTAL STRUCTURE OF THE RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE OXIDIZED RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
Crystal structure of mammalian capping enzyme (Mce1) and Pol II CTD complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000029942
AA Change: T404A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029942
Gene: ENSMUSG00000028274
AA Change: T404A

DomainStartEndE-ValueType
Pfam:DSPc 46 179 4.7e-12 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 1.8e-73 PFAM
Pfam:mRNA_cap_C 463 550 3.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108153
AA Change: T404A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103788
Gene: ENSMUSG00000028274
AA Change: T404A

DomainStartEndE-ValueType
Pfam:DSPc 47 179 2.2e-13 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 2e-80 PFAM
Pfam:mRNA_cap_C 464 559 1.9e-22 PFAM
low complexity region 577 590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Rngtt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Rngtt APN 4 33325157 splice site probably benign
IGL01945:Rngtt APN 4 33339073 missense probably damaging 1.00
IGL02104:Rngtt APN 4 33320517 critical splice acceptor site probably null
IGL02505:Rngtt APN 4 33337936 missense possibly damaging 0.75
IGL02679:Rngtt APN 4 33356098 missense possibly damaging 0.65
IGL03309:Rngtt APN 4 33339091 missense probably damaging 1.00
R0013:Rngtt UTSW 4 33379409 missense probably benign 0.01
R0626:Rngtt UTSW 4 33329598 splice site probably null
R0633:Rngtt UTSW 4 33368690 missense probably damaging 1.00
R1645:Rngtt UTSW 4 33362939 missense probably damaging 1.00
R1670:Rngtt UTSW 4 33368660 missense probably benign
R1700:Rngtt UTSW 4 33330864 missense probably damaging 1.00
R1754:Rngtt UTSW 4 33329634 splice site probably null
R1809:Rngtt UTSW 4 33443614 missense probably benign 0.04
R1929:Rngtt UTSW 4 33500302 nonsense probably null
R2271:Rngtt UTSW 4 33500302 nonsense probably null
R3773:Rngtt UTSW 4 33330889 missense probably damaging 1.00
R4445:Rngtt UTSW 4 33499035 missense probably benign
R4449:Rngtt UTSW 4 33330865 missense probably damaging 1.00
R4510:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4511:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4578:Rngtt UTSW 4 33339050 missense probably benign 0.30
R4610:Rngtt UTSW 4 33339133 intron probably benign
R4712:Rngtt UTSW 4 33379394 missense probably benign 0.00
R4888:Rngtt UTSW 4 33500335 missense unknown
R4911:Rngtt UTSW 4 33500292 splice site probably null
R5248:Rngtt UTSW 4 33325110 nonsense probably null
R6429:Rngtt UTSW 4 33320606 nonsense probably null
R6571:Rngtt UTSW 4 33379413 missense probably damaging 1.00
R7260:Rngtt UTSW 4 33356176 missense possibly damaging 0.52
R7298:Rngtt UTSW 4 33362927 missense probably damaging 1.00
R7379:Rngtt UTSW 4 33498981 nonsense probably null
R8163:Rngtt UTSW 4 33325109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCACTAGACATCTCCAAGGATTG -3'
(R):5'- TGCTGAAGAAGAGACCCTGG -3'

Sequencing Primer
(F):5'- GACTATAGCATAGAGTACTGCAACC -3'
(R):5'- CTGAAGAAGAGACCCTGGGTGTC -3'
Posted On2014-12-04