Incidental Mutation 'R2844:Zbtb8os'
ID251418
Institutional Source Beutler Lab
Gene Symbol Zbtb8os
Ensembl Gene ENSMUSG00000057572
Gene Namezinc finger and BTB domain containing 8 opposite strand
SynonymsArch, 2010001H09Rik, 2310028N13Rik
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R2844 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129335695-129354547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129341516 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 54 (E54D)
Ref Sequence ENSEMBL: ENSMUSP00000113004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119480] [ENSMUST00000141235] [ENSMUST00000146767]
Predicted Effect unknown
Transcript: ENSMUST00000106047
AA Change: N44I
Predicted Effect probably damaging
Transcript: ENSMUST00000119480
AA Change: E54D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113004
Gene: ENSMUSG00000057572
AA Change: E54D

DomainStartEndE-ValueType
Pfam:Archease 31 119 4.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140272
Predicted Effect probably damaging
Transcript: ENSMUST00000141235
AA Change: E54D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120925
Gene: ENSMUSG00000057572
AA Change: E54D

DomainStartEndE-ValueType
Pfam:Archease 31 167 3.3e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146767
AA Change: E54D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114628
Gene: ENSMUSG00000057572
AA Change: E54D

DomainStartEndE-ValueType
Pfam:Archease 31 145 3.5e-40 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Zbtb8os
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0597:Zbtb8os UTSW 4 129346877 missense probably damaging 1.00
R2843:Zbtb8os UTSW 4 129341516 missense probably damaging 0.99
R2845:Zbtb8os UTSW 4 129341516 missense probably damaging 0.99
R2846:Zbtb8os UTSW 4 129341516 missense probably damaging 0.99
R4132:Zbtb8os UTSW 4 129336113 missense probably damaging 1.00
R4714:Zbtb8os UTSW 4 129341764 missense probably damaging 0.98
R5138:Zbtb8os UTSW 4 129346926 intron probably benign
R5579:Zbtb8os UTSW 4 129340735 missense probably damaging 0.99
R6019:Zbtb8os UTSW 4 129340749 missense possibly damaging 0.93
R6265:Zbtb8os UTSW 4 129335982 start gained probably benign
R6365:Zbtb8os UTSW 4 129343152 missense possibly damaging 0.89
Z1176:Zbtb8os UTSW 4 129341521 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCCTATATGGGTGTCGTCAAATTAGAC -3'
(R):5'- TCCCCTACAGAGTGGAAAGGAC -3'

Sequencing Primer
(F):5'- GGTGTCGTCAAATTAGACATGTAG -3'
(R):5'- GTTCAGAATCCACCCTGAGG -3'
Posted On2014-12-04