Incidental Mutation 'R2844:Ppfia3'
ID 251428
Institutional Source Beutler Lab
Gene Symbol Ppfia3
Ensembl Gene ENSMUSG00000003863
Gene Name protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock # R2844 (G1)
Quality Score 203
Status Validated
Chromosome 7
Chromosomal Location 45339122-45367019 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 45356428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 348 (R348L)
Ref Sequence ENSEMBL: ENSMUSP00000148200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000210248] [ENSMUST00000211067]
AlphaFold P60469
Predicted Effect probably damaging
Transcript: ENSMUST00000003961
AA Change: R348L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863
AA Change: R348L

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107779
AA Change: R348L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103408
Gene: ENSMUSG00000003863
AA Change: R348L

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137578
AA Change: R197L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118183
Gene: ENSMUSG00000003863
AA Change: R197L

DomainStartEndE-ValueType
coiled coil region 16 275 N/A INTRINSIC
coiled coil region 297 349 N/A INTRINSIC
low complexity region 383 399 N/A INTRINSIC
coiled coil region 446 491 N/A INTRINSIC
low complexity region 500 521 N/A INTRINSIC
low complexity region 556 568 N/A INTRINSIC
SAM 684 753 1.46e-10 SMART
SAM 790 857 8.22e-5 SMART
SAM 878 950 3.58e-5 SMART
low complexity region 996 1009 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210248
AA Change: R197L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210586
Predicted Effect probably damaging
Transcript: ENSMUST00000211067
AA Change: R348L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4975 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. Liprin family protein has been shown to localize phosphatase LAR to cell focal adhesions and may be involved in the molecular organization of presynaptic active zones. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Ppfia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ppfia3 APN 7 45360057 splice site probably null
IGL02086:Ppfia3 APN 7 45340572 unclassified probably benign
IGL02160:Ppfia3 APN 7 45360051 splice site probably benign
IGL02373:Ppfia3 APN 7 45358849 missense probably damaging 0.98
IGL02417:Ppfia3 APN 7 45341717 missense probably damaging 0.98
IGL02501:Ppfia3 APN 7 45354938 splice site probably benign
IGL02638:Ppfia3 APN 7 45356668 missense probably damaging 1.00
IGL03084:Ppfia3 APN 7 45340227 missense probably benign 0.00
R0207:Ppfia3 UTSW 7 45348534 missense probably damaging 1.00
R0962:Ppfia3 UTSW 7 45347722 splice site probably benign
R1086:Ppfia3 UTSW 7 45361758 missense probably damaging 1.00
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1566:Ppfia3 UTSW 7 45340688 missense probably damaging 1.00
R1677:Ppfia3 UTSW 7 45356666 missense probably benign 0.03
R1876:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.75
R2219:Ppfia3 UTSW 7 45354890 nonsense probably null
R2336:Ppfia3 UTSW 7 45356697 splice site probably null
R2843:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R2846:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R4669:Ppfia3 UTSW 7 45352093 missense probably damaging 1.00
R4777:Ppfia3 UTSW 7 45341157 missense probably damaging 1.00
R4787:Ppfia3 UTSW 7 45340626 missense possibly damaging 0.89
R4994:Ppfia3 UTSW 7 45341118 missense probably damaging 1.00
R5042:Ppfia3 UTSW 7 45342341 missense probably damaging 1.00
R5821:Ppfia3 UTSW 7 45353616 missense probably damaging 0.96
R6116:Ppfia3 UTSW 7 45354703 missense probably damaging 1.00
R6515:Ppfia3 UTSW 7 45340233 missense possibly damaging 0.94
R6868:Ppfia3 UTSW 7 45353612 missense probably damaging 1.00
R6920:Ppfia3 UTSW 7 45358807 missense possibly damaging 0.46
R6935:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.47
R6978:Ppfia3 UTSW 7 45346848 missense probably benign 0.02
R7017:Ppfia3 UTSW 7 45358800 missense probably benign
R7027:Ppfia3 UTSW 7 45354736 missense possibly damaging 0.80
R7078:Ppfia3 UTSW 7 45360595 missense probably damaging 1.00
R7256:Ppfia3 UTSW 7 45341743 missense probably benign 0.43
R7378:Ppfia3 UTSW 7 45361446 splice site probably null
R7570:Ppfia3 UTSW 7 45340748 critical splice acceptor site probably null
R7814:Ppfia3 UTSW 7 45352262 missense probably benign
R8298:Ppfia3 UTSW 7 45360194 missense probably damaging 1.00
R8712:Ppfia3 UTSW 7 45361705 missense probably benign 0.43
R8781:Ppfia3 UTSW 7 45348529 missense possibly damaging 0.94
R8843:Ppfia3 UTSW 7 45348517 missense probably benign 0.02
R8901:Ppfia3 UTSW 7 45341717 missense probably damaging 1.00
R8984:Ppfia3 UTSW 7 45340676 missense probably damaging 1.00
R9149:Ppfia3 UTSW 7 45350293 critical splice acceptor site probably null
R9284:Ppfia3 UTSW 7 45361798 missense probably damaging 1.00
R9427:Ppfia3 UTSW 7 45358789 missense possibly damaging 0.46
R9683:Ppfia3 UTSW 7 45356575 missense probably benign 0.29
R9803:Ppfia3 UTSW 7 45341115 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGTTCCCATGGCGTTCCTC -3'
(R):5'- ATGATGCCAACGACAAGCTGG -3'

Sequencing Primer
(F):5'- TTCCTCAGCCTAGTGGACAG -3'
(R):5'- CTGGAGAATGAGTTGGCCAGC -3'
Posted On 2014-12-04