Incidental Mutation 'R2844:Psme4'
ID251444
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Nameproteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 040437-MU
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2844 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location30771726-30880361 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 30845173 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
Predicted Effect probably benign
Transcript: ENSMUST00000041231
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCTTACTCATGCCTTTTG -3'
(R):5'- CGTGACTTACTTTGGCCAGTTG -3'

Sequencing Primer
(F):5'- TTCCAAGGGGATGCCTGTAACTAAC -3'
(R):5'- CCAGTTGTAGTATCCCCAGTGAG -3'
Posted On2014-12-04