Incidental Mutation 'R2508:Pak6'
ID251447
Institutional Source Beutler Lab
Gene Symbol Pak6
Ensembl Gene ENSMUSG00000074923
Gene Namep21 (RAC1) activated kinase 6
Synonyms
MMRRC Submission 040414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2508 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118663303-118698020 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 118694569 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 559 (R559*)
Ref Sequence ENSEMBL: ENSMUSP00000106477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099557] [ENSMUST00000104937] [ENSMUST00000110853]
Predicted Effect probably null
Transcript: ENSMUST00000099557
AA Change: R559*
SMART Domains Protein: ENSMUSP00000097153
Gene: ENSMUSG00000074923
AA Change: R559*

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104937
SMART Domains Protein: ENSMUSP00000100542
Gene: ENSMUSG00000078137

DomainStartEndE-ValueType
ANK 46 79 1.87e0 SMART
ANK 83 112 3.23e-4 SMART
ANK 116 145 3.44e1 SMART
low complexity region 193 247 N/A INTRINSIC
low complexity region 331 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110853
AA Change: R559*
SMART Domains Protein: ENSMUSP00000106477
Gene: ENSMUSG00000074923
AA Change: R559*

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132577
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele do not exhibit any abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,393 T20I probably benign Het
Adamts2 C T 11: 50,788,689 T832I possibly damaging Het
Agbl1 G A 7: 76,589,550 probably null Het
Ankrd61 T C 5: 143,897,076 probably benign Het
Anpep T G 7: 79,838,291 Y506S possibly damaging Het
Aox2 T A 1: 58,343,673 H1037Q probably benign Het
Auh G A 13: 52,898,719 R47* probably null Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh3 T C 8: 106,552,407 L667P probably damaging Het
Cenpe A T 3: 135,241,073 R1116S possibly damaging Het
Ces1b T A 8: 93,073,341 M136L possibly damaging Het
Cfap54 T C 10: 92,997,374 E1130G possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clu T C 14: 65,975,003 V135A probably damaging Het
Cmip T A 8: 117,436,693 S388T probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Crym T C 7: 120,201,827 N33S probably benign Het
Ctcf T A 8: 105,671,384 V434E probably damaging Het
D430042O09Rik T A 7: 125,795,343 V197D probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dcaf13 A G 15: 39,145,152 Y383C probably benign Het
Dock2 T C 11: 34,312,485 T957A probably benign Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Fads3 A G 19: 10,056,454 Y401C probably damaging Het
Fam72a T C 1: 131,528,854 probably null Het
Fbxw21 C A 9: 109,145,485 K322N probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Glb1l T C 1: 75,201,829 T322A probably damaging Het
Gm6803 T C 12: 88,018,488 Y95C probably damaging Het
Gm6871 T A 7: 41,547,990 T149S probably benign Het
Gpr26 C T 7: 131,967,094 T56I probably damaging Het
Grik4 C A 9: 42,622,142 G361C probably damaging Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Igsf5 T A 16: 96,364,047 D7E probably benign Het
Inpp5e T A 2: 26,399,343 I522F probably damaging Het
Insm2 C A 12: 55,600,311 T280K probably benign Het
Itih4 T C 14: 30,895,478 V585A probably damaging Het
Knl1 A T 2: 119,058,368 R17* probably null Het
Lag3 G T 6: 124,911,309 L15I possibly damaging Het
Lepr T A 4: 101,790,896 S861T probably damaging Het
Mcur1 A T 13: 43,544,465 Y320N probably damaging Het
Mgam A T 6: 40,759,783 D872V probably damaging Het
Mlycd T C 8: 119,407,707 probably null Het
Mpl C A 4: 118,455,757 C193F probably damaging Het
Mycbp2 C A 14: 103,131,245 A4142S probably damaging Het
Myh1 T A 11: 67,213,598 D993E possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Neb T C 2: 52,195,521 I1521V probably benign Het
Notch1 A G 2: 26,465,473 V1744A possibly damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1056 A G 2: 86,356,364 L6P possibly damaging Het
Olfr1181 T C 2: 88,423,456 T190A possibly damaging Het
Olfr798 T A 10: 129,625,915 I49L probably benign Het
Otogl A G 10: 107,874,500 L576P probably damaging Het
P2ry1 C T 3: 61,003,479 T13M probably damaging Het
Papd4 A G 13: 93,184,218 L109S probably damaging Het
Parvb A T 15: 84,297,970 M234L probably benign Het
Pcdha11 T C 18: 37,012,854 V666A possibly damaging Het
Pde3b T A 7: 114,526,857 Y775* probably null Het
Pgam5 A G 5: 110,266,003 L98P probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkib T G 10: 57,728,109 D4E probably damaging Het
Plcb1 A T 2: 135,260,508 I202F probably benign Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Prdm1 T A 10: 44,446,807 T249S probably benign Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Prune2 A G 19: 17,122,622 E1830G probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rassf2 A T 2: 131,998,243 probably null Het
Rnf185 A G 11: 3,418,067 Y204H probably benign Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Scn11a T A 9: 119,765,529 Y1266F probably damaging Het
Senp7 T A 16: 56,151,362 H287Q probably benign Het
Sgsm3 T C 15: 81,003,872 probably null Het
Slc25a11 A T 11: 70,645,832 V104E possibly damaging Het
Slc25a13 G A 6: 6,117,190 T175I probably benign Het
Slc26a3 T A 12: 31,470,903 F702Y probably damaging Het
Smco2 T A 6: 146,859,967 L184H probably damaging Het
Ssc4d A T 5: 135,965,607 C90S probably damaging Het
Sspo T C 6: 48,464,364 S1835P probably damaging Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Syngr1 C T 15: 80,111,740 T160M probably damaging Het
Tgfb1i1 A G 7: 128,248,913 probably null Het
Thoc1 T A 18: 9,977,947 V296E probably damaging Het
Timp2 C T 11: 118,310,586 C75Y probably damaging Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tprn G A 2: 25,268,928 E655K possibly damaging Het
Trbv14 A C 6: 41,135,490 I74L probably benign Het
Trbv5 T A 6: 41,062,621 Y53* probably null Het
Trpm5 T C 7: 143,088,919 Q97R possibly damaging Het
Tut1 A G 19: 8,955,567 D88G probably damaging Het
Ucp2 A T 7: 100,498,413 I200F probably benign Het
Unc45a G A 7: 80,338,875 S131L probably benign Het
Uty A T Y: 1,158,182 H573Q probably damaging Het
Vmn1r17 T A 6: 57,360,870 Y121F possibly damaging Het
Vmn1r53 T C 6: 90,223,572 I257V probably benign Het
Vmn2r90 C T 17: 17,733,967 L798F probably damaging Het
Vmn2r94 A T 17: 18,257,474 M225K probably benign Het
Wdr24 A T 17: 25,824,299 I32F possibly damaging Het
Zc3h11a T A 1: 133,624,783 T529S probably benign Het
Zc3h4 A G 7: 16,434,339 H791R unknown Het
Zfp24 A G 18: 24,017,870 L73P probably damaging Het
Zfp616 T C 11: 74,083,295 I130T probably benign Het
Zim1 ACAGCAG ACAGCAGCAG 7: 6,677,430 probably benign Het
Zim1 CAG CAGAAG 7: 6,677,431 probably benign Het
Other mutations in Pak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pak6 APN 2 118689845 missense possibly damaging 0.58
IGL00979:Pak6 APN 2 118696482 missense probably damaging 1.00
IGL01577:Pak6 APN 2 118693648 missense probably benign 0.00
IGL01928:Pak6 APN 2 118689864 missense probably damaging 1.00
IGL01951:Pak6 APN 2 118693260 missense probably benign
IGL02387:Pak6 APN 2 118693233 missense probably benign
IGL03302:Pak6 APN 2 118693303 missense probably benign
bedamned UTSW 2 118694007 splice site probably benign
bequeathed UTSW 2 118693522 missense probably damaging 0.96
R0126:Pak6 UTSW 2 118690332 missense possibly damaging 0.86
R0883:Pak6 UTSW 2 118693687 missense probably damaging 1.00
R1128:Pak6 UTSW 2 118696509 missense probably benign 0.00
R2073:Pak6 UTSW 2 118688851 missense probably damaging 1.00
R2920:Pak6 UTSW 2 118694007 splice site probably benign
R3118:Pak6 UTSW 2 118689741 missense probably damaging 1.00
R3689:Pak6 UTSW 2 118693440 nonsense probably null
R3762:Pak6 UTSW 2 118696477 missense probably damaging 0.99
R4589:Pak6 UTSW 2 118696540 missense probably damaging 1.00
R4976:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5119:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5206:Pak6 UTSW 2 118693303 missense probably benign
R5683:Pak6 UTSW 2 118693912 missense probably damaging 1.00
R7232:Pak6 UTSW 2 118693522 missense probably damaging 0.96
R7236:Pak6 UTSW 2 118693428 missense probably benign 0.26
R7292:Pak6 UTSW 2 118693591 missense possibly damaging 0.95
R7623:Pak6 UTSW 2 118694587 missense probably damaging 1.00
R7823:Pak6 UTSW 2 118695312 missense probably benign 0.02
R8190:Pak6 UTSW 2 118690097 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGGCCTTGGCTTACCTG -3'
(R):5'- AGAACCGGGGTCATTAATAGTG -3'

Sequencing Primer
(F):5'- AAGAGTGATTCCATCCTGCTGAC -3'
(R):5'- CCGGGGTCATTAATAGTGGAAATAC -3'
Posted On2014-12-04